Rmu_sc0008522.1_g000002

ethylene-responsive transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008522.1
OG0025624
Physical Location & Seq
Forward (+)
5679 .. 5999
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008522.1_g000002.1.cds

Sequence Viewer

Length: 321 bp
atgcaacaccttgcctccctctcttccccgaaaaccactcaccttcatcttcaacctctatccttctctagttcactttttcatacccgaaagctcagacccagaacagaagaatttagggtcaagaagaagcgacggccaatacgaagcgatgagccgtacaaggggatatggatagccgagattcacgagccaaacaagcgctcccggatttggcttgggttatactcgactccggtgacggctgctcccaatgaaggaggagtgcaggggcattttcatcaaaccccccacggacccaacttggctcctccccattaa

Protein Analysis

106

Amino Acids

12.15

Weight (kDa)

10.72

Isoelectric Point (pI)

67.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025624)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0008522.1_g000002 Rmu_sc0013135.1_g000003
rosa_samantha Rh2AG376100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 137
AcsI RAATTY 1 cut(s) 113
AfaI GTAC 1 cut(s) 161
AfeI AGCGCT 1 cut(s) 203
AfiI CCNNNNNNNGG 3 cut(s) 164, 213, 257
AgsI TTSAA 1 cut(s) 53
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Aor51HI AGCGCT 1 cut(s) 203
AoxI GGCC 1 cut(s) 137
ApeKI GCWGC 1 cut(s) 245
ApoI RAATTY 1 cut(s) 113
AspLEI GCGC 1 cut(s) 204
AspS9I GGNCC 1 cut(s) 296
AsuC2I CCSGG 1 cut(s) 208
AsuHPI GGTGA 2 cut(s) 32, 250
AvaII GGWCC 1 cut(s) 296
BauI CACGAG 1 cut(s) 188
BbvI GCAGC 1 cut(s) 232
BceAI ACGGC 3 cut(s) 142, 152, 258
BcnI CCSGG 1 cut(s) 208
BfaI CTAG 1 cut(s) 69
BfoI RGCGCY 1 cut(s) 205
BisI GCNGC 1 cut(s) 246
BlsI GCNGC 1 cut(s) 247
Bme1390I CCNGG 1 cut(s) 208
Bme18I GGWCC 1 cut(s) 296
BmgT120I GGNCC 1 cut(s) 296
BmiI GGNNCC 2 cut(s) 298, 309
BmrFI CCNGG 1 cut(s) 208
BpuMI CCSGG 1 cut(s) 208
BsaJI CCNNGG 1 cut(s) 292
BsaWI WCCGGW 1 cut(s) 235
BsaXI ACNNNNNCTCC 5 cut(s) 29, 188, 218, 232, 262
Bsc4I CCNNNNNNNGG 3 cut(s) 164, 213, 257
BseDI CCNNGG 1 cut(s) 292
BseLI CCNNNNNNNGG 3 cut(s) 164, 213, 257
BseMII CTCAG 1 cut(s) 109
BseRI GAGGAG 2 cut(s) 276, 300
BseXI GCAGC 1 cut(s) 232
BsgI GTGCAG 1 cut(s) 287
BshFI GGCC 1 cut(s) 139
BsiSI CCGG 2 cut(s) 208, 236
BslI CCNNNNNNNGG 3 cut(s) 164, 213, 257
BsnI GGCC 1 cut(s) 139
BspANI GGCC 1 cut(s) 139
BspCNI CTCAG 1 cut(s) 108
BspLI GGNNCC 2 cut(s) 298, 309
BssECI CCNNGG 1 cut(s) 292
BssSI CACGAG 1 cut(s) 188
Bst2BI CACGAG 1 cut(s) 188
Bst6I CTCTTC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 95
BstDSI CCRYGG 1 cut(s) 292
BstH2I RGCGCY 1 cut(s) 205
BstHHI GCGC 1 cut(s) 204
BstMWI GCNNNNNNNGC 1 cut(s) 199
BstSCI CCNGG 1 cut(s) 206
BstV1I GCAGC 1 cut(s) 232
BsuRI GGCC 1 cut(s) 139
BtgI CCRYGG 1 cut(s) 292
BtgZI GCGATG 1 cut(s) 165
CfoI GCGC 1 cut(s) 204
Cfr13I GGNCC 1 cut(s) 296
Csp6I GTAC 1 cut(s) 160
CviJI RGCY 8 cut(s) 94, 139, 157, 179, 193, 217, 245, 308
CviKI_1 RGCY 8 cut(s) 94, 139, 157, 179, 193, 217, 245, 308
CviQI GTAC 1 cut(s) 160
DdeI CTNAG 1 cut(s) 95
EaeI YGGCCR 1 cut(s) 137
Eam1104I CTCTTC 1 cut(s) 28
EarI CTCTTC 1 cut(s) 28
Eco47I GGWCC 1 cut(s) 296
Eco47III AGCGCT 1 cut(s) 203
FaiI YATR 3 cut(s) 84, 172, 226
Fnu4HI GCNGC 1 cut(s) 246
Fsp4HI GCNGC 1 cut(s) 246
FspBI CTAG 1 cut(s) 69
GlaI GCGC 1 cut(s) 203
GluI GCNGC 1 cut(s) 246
HaeII RGCGCY 1 cut(s) 205
HaeIII GGCC 1 cut(s) 139
HapII CCGG 2 cut(s) 208, 236
HhaI GCGC 1 cut(s) 204
Hin6I GCGC 1 cut(s) 202
HinP1I GCGC 1 cut(s) 202
HinfI GANTC 2 cut(s) 184, 232
HpaII CCGG 2 cut(s) 208, 236
HphI GGTGA 2 cut(s) 32, 250
Hpy166II GTNNAC 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 98
Hpy188III TCNNGA 2 cut(s) 124, 188
Hpy8I GTNNAC 1 cut(s) 74
Hpy99I CGWCG 1 cut(s) 138
HpyAV CCTTC 3 cut(s) 53, 73, 251
HpyCH4V TGCA 2 cut(s) 4, 268
HpyF10VI GCNNNNNNNGC 1 cut(s) 199
HpyF3I CTNAG 1 cut(s) 95
HspAI GCGC 1 cut(s) 202
LmnI GCTCC 3 cut(s) 209, 253, 313
LpnPI CCDG 4 cut(s) 115, 221, 249, 254
Lsp1109I GCAGC 1 cut(s) 232
MaeI CTAG 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 238
MboII GAAGA 4 cut(s) 15, 41, 122, 139
MluCI AATT 1 cut(s) 113
MlyI GAGTC 1 cut(s) 226
MnlI CCTC 5 cut(s) 25, 29, 66, 254, 321
MseI TTAA 1 cut(s) 319
MspI CCGG 2 cut(s) 208, 236
MspR9I CCNGG 1 cut(s) 208
MwoI GCNNNNNNNGC 1 cut(s) 199
NciI CCSGG 1 cut(s) 208
NlaIV GGNNCC 2 cut(s) 298, 309
NmeAIII GCCGAG 1 cut(s) 205
NmuCI GTSAC 1 cut(s) 238
PcsI WCGNNNNNNNCGW 1 cut(s) 142
PfeI GAWTC 1 cut(s) 184
PfoI TCCNGGA 1 cut(s) 206
PkrI GCNGC 1 cut(s) 247
PleI GAGTC 1 cut(s) 226
PpsI GAGTC 1 cut(s) 226
PspN4I GGNNCC 2 cut(s) 298, 309
PspPI GGNCC 1 cut(s) 296
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
SaqAI TTAA 1 cut(s) 319
SatI GCNGC 1 cut(s) 246
Sau96I GGNCC 1 cut(s) 296
SchI GAGTC 1 cut(s) 226
ScrFI CCNGG 1 cut(s) 208
SetI ASST 4 cut(s) 12, 45, 58, 96
SinI GGWCC 1 cut(s) 296
Sse9I AATT 1 cut(s) 113
SspMI CTAG 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 206
TaqI TCGA 1 cut(s) 230
TasI AATT 1 cut(s) 113
TfiI GAWTC 1 cut(s) 184
Tru1I TTAA 1 cut(s) 319
Tru9I TTAA 1 cut(s) 319
TseFI GTSAC 1 cut(s) 238
TseI GCWGC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 238
TspDTI ATGAA 4 cut(s) 35, 71, 269, 270
TspGWI ACGGA 1 cut(s) 309
VpaK11BI GGWCC 1 cut(s) 296
XapI RAATTY 1 cut(s) 113
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.