Rmu_sc0009291.1_g000013

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009291.1
Physical Location & Seq
Forward (+)
62282 .. 65833
3552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009291.1_g000013.1.cds

Sequence Viewer

Length: 1095 bp
atggatagacttagcaactttccagatgagttagtagacaaaattttatgtattttgccaattcagcaggctgtgaagacatgtgttttatcaagcacatggcggtatacatcaaataggctttcacaacttgtgttcgattggaagcataacgggaattggagcaacccagagtttgtcgaaatggttgatcatgtactctcaaatcatgttgggcccatatacaggtttaaaatagagcgtcttgagtttctagacccaagtgacattgatcgatggatttttcatgtatcaagaaactctgtcaaagagttcatacttgatagcttccaaagggaaccctacaagatccctgaatgtttgtattcctgccaagatattacatctctcactttatgtggttgcttactagatccacctcctacattcagaggattcgtgagcttgaagagaattgaattttatgacgtttccctggcccaagatgtatttgacaatatgcttggttactgtcctttgcttgaagtgttgattttgcaatgctgtgatggtttcaccaatttccgtattaatgcaccaaaactccaatatcttaactttgaaggttcttttgatgatgttactctcaagaacacttcaaaccttactgatattaccatttctatgtgtgaacgaagttttgctggtggtggttctagtaatttggtcaagtttttcagtgacctgcctcgaattcaaaggctcacaattaagaattactttttaaaggcatcttttgtacttgggaaagaatgcaaggacctcacagagggggtgaagaaggctacattcaagggatataacaccattgcggaaactgtggatgttattaagaaaccgcaacgccatgaccctacgataagcctaccagcttggccatatgatgttcccttagaagccagaatgttaatgtttggagaaggatcgggatcttctacccgacacacaaatgctgatcatttgaaagcaacaattgacttgaatggtcataaagtgatagttgaacgaaatgttgatgcaatttctaatctcatgtctaatctatttttgaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

364

Amino Acids

41.63

Weight (kDa)

6.09

Isoelectric Point (pI)

31.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031427)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0009291.1_g000013
rosa_rugosa Rorug01G0105800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 732
AccI GTMKAC 2 cut(s) 36, 107
AciI CCGC 3 cut(s) 103, 851, 878
AclWI GGATC 4 cut(s) 343, 407, 970, 976
AcoI YGGCCR 1 cut(s) 914
AcsI RAATTY 3 cut(s) 42, 458, 732
AfaI GTAC 2 cut(s) 198, 780
AfiI CCNNNNNNNGG 2 cut(s) 225, 808
AflIII ACRYGT 1 cut(s) 80
AjnI CCWGG 1 cut(s) 474
AluBI AGCT 3 cut(s) 327, 444, 911
AluI AGCT 3 cut(s) 327, 444, 911
AlwI GGATC 4 cut(s) 343, 407, 970, 976
AoxI GGCC 3 cut(s) 215, 477, 914
ApaI GGGCCC 1 cut(s) 219
ApoI RAATTY 3 cut(s) 42, 458, 732
AseI ATTAAT 1 cut(s) 570
AspS9I GGNCC 4 cut(s) 215, 216, 478, 799
AsuHPI GGTGA 2 cut(s) 547, 826
AvaII GGWCC 1 cut(s) 799
BaeGI GKGCMC 1 cut(s) 219
BalI TGGCCA 1 cut(s) 916
BanII GRGCYC 1 cut(s) 219
BbsI GAAGAC 1 cut(s) 83
BccI CCATC 2 cut(s) 270, 542
BciT130I CCWGG 1 cut(s) 476
BclI TGATCA 2 cut(s) 190, 994
BfaI CTAG 3 cut(s) 254, 410, 696
BfuAI ACCTGC 1 cut(s) 732
Bme1390I CCNGG 1 cut(s) 476
Bme18I GGWCC 1 cut(s) 799
BmgT120I GGNCC 4 cut(s) 215, 216, 478, 799
BmiI GGNNCC 2 cut(s) 217, 339
BmrFI CCNGG 1 cut(s) 476
BmsI GCATC 2 cut(s) 779, 1045
BpiI GAAGAC 1 cut(s) 83
BpuEI CTTGAG 2 cut(s) 266, 611
Bsa29I ATCGAT 1 cut(s) 274
BsaBI GATNNNNATC 1 cut(s) 967
BsaJI CCNNGG 1 cut(s) 474
BsaXI ACNNNNNCTCC 2 cut(s) 567, 597
Bsc4I CCNNNNNNNGG 2 cut(s) 225, 808
Bse3DI GCAATG 2 cut(s) 545, 846
Bse8I GATNNNNATC 1 cut(s) 967
BseBI CCWGG 1 cut(s) 476
BseCI ATCGAT 1 cut(s) 274
BseDI CCNNGG 1 cut(s) 474
BseGI GGATG 1 cut(s) 868
BseJI GATNNNNATC 1 cut(s) 967
BseLI CCNNNNNNNGG 2 cut(s) 225, 808
BseMI GCAATG 2 cut(s) 545, 846
BseSI GKGCMC 1 cut(s) 219
BshFI GGCC 3 cut(s) 217, 479, 916
BshVI ATCGAT 1 cut(s) 274
BslI CCNNNNNNNGG 2 cut(s) 225, 808
BsmI GAATGC 1 cut(s) 797
BsnI GGCC 3 cut(s) 217, 479, 916
Bsp120I GGGCCC 1 cut(s) 215
Bsp1286I GDGCHC 1 cut(s) 219
Bsp143I GATC 7 cut(s) 190, 271, 348, 412, 962, 968, 994
BspACI CCGC 3 cut(s) 103, 851, 878
BspANI GGCC 3 cut(s) 217, 479, 916
BspDI ATCGAT 1 cut(s) 274
BspLI GGNNCC 2 cut(s) 217, 339
BspMI ACCTGC 1 cut(s) 732
BspPI GGATC 4 cut(s) 343, 407, 970, 976
BsrDI GCAATG 2 cut(s) 545, 846
BssECI CCNNGG 1 cut(s) 474
BssMI GATC 7 cut(s) 190, 271, 348, 412, 962, 968, 994
BssNAI GTATAC 1 cut(s) 108
Bst1107I GTATAC 1 cut(s) 108
Bst2UI CCWGG 1 cut(s) 476
Bst4CI ACNGT 2 cut(s) 512, 859
Bst6I CTCTTC 1 cut(s) 443
BstC8I GCNNGC 1 cut(s) 69
BstDEI CTNAG 2 cut(s) 11, 931
BstENI CCTNNNNNAGG 1 cut(s) 806
BstF5I GGATG 1 cut(s) 868
BstKTI GATC 7 cut(s) 193, 274, 351, 415, 965, 971, 997
BstMBI GATC 7 cut(s) 190, 271, 348, 412, 962, 968, 994
BstMWI GCNNNNNNNGC 1 cut(s) 64
BstNI CCWGG 1 cut(s) 476
BstNSI RCATGY 1 cut(s) 84
BstSCI CCNGG 1 cut(s) 474
BstSLI GKGCMC 1 cut(s) 219
BstV2I GAAGAC 1 cut(s) 83
BstX2I RGATCY 3 cut(s) 348, 412, 968
BstYI RGATCY 3 cut(s) 348, 412, 968
BstZ17I GTATAC 1 cut(s) 108
Bsu15I ATCGAT 1 cut(s) 274
BsuRI GGCC 3 cut(s) 217, 479, 916
BsuTUI ATCGAT 1 cut(s) 274
BtsCI GGATG 1 cut(s) 868
BtsIMutI CAGTG 1 cut(s) 724
BveI ACCTGC 1 cut(s) 732
Cac8I GCNNGC 1 cut(s) 69
Cfr13I GGNCC 4 cut(s) 215, 216, 478, 799
ClaI ATCGAT 1 cut(s) 274
CseI GACGC 1 cut(s) 230
Csp6I GTAC 2 cut(s) 197, 779
CviAII CATG 7 cut(s) 81, 99, 194, 209, 287, 887, 1072
CviQI GTAC 2 cut(s) 197, 779
DdeI CTNAG 2 cut(s) 11, 931
DpnI GATC 7 cut(s) 192, 273, 350, 414, 964, 970, 996
DpnII GATC 7 cut(s) 190, 271, 348, 412, 962, 968, 994
DraI TTTAAA 2 cut(s) 232, 765
EaeI YGGCCR 1 cut(s) 914
Eam1104I CTCTTC 1 cut(s) 443
EarI CTCTTC 1 cut(s) 443
Eco24I GRGCYC 1 cut(s) 219
Eco47I GGWCC 1 cut(s) 799
EcoNI CCTNNNNNAGG 1 cut(s) 806
EcoO109I RGGNCCY 1 cut(s) 799
EcoRI GAATTC 1 cut(s) 732
EcoRII CCWGG 1 cut(s) 474
EcoT38I GRGCYC 1 cut(s) 219
FaeI CATG 7 cut(s) 84, 102, 197, 212, 290, 890, 1075
FalI AAGNNNNNCTT 2 cut(s) 743, 775
FatI CATG 7 cut(s) 80, 98, 193, 208, 286, 886, 1071
FauNDI CATATG 1 cut(s) 919
FbaI TGATCA 2 cut(s) 190, 994
FblI GTMKAC 2 cut(s) 36, 107
FokI GGATG 1 cut(s) 875
FriOI GRGCYC 1 cut(s) 219
FspBI CTAG 3 cut(s) 254, 410, 696
HaeIII GGCC 3 cut(s) 217, 479, 916
HgaI GACGC 1 cut(s) 230
Hin1II CATG 7 cut(s) 84, 102, 197, 212, 290, 890, 1075
HinfI GANTC 1 cut(s) 435
HphI GGTGA 2 cut(s) 547, 826
Hpy166II GTNNAC 3 cut(s) 37, 108, 671
Hpy188I TCNGA 1 cut(s) 431
Hpy188III TCNNGA 7 cut(s) 23, 245, 254, 294, 439, 628, 966
Hpy8I GTNNAC 3 cut(s) 37, 108, 671
HpyAV CCTTC 3 cut(s) 596, 814, 953
HpyCH4III ACNGT 2 cut(s) 512, 859
HpyCH4IV ACGT 1 cut(s) 468
HpyCH4V TGCA 4 cut(s) 538, 575, 795, 1058
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
HpyF3I CTNAG 2 cut(s) 11, 931
HpySE526I ACGT 1 cut(s) 468
Hsp92II CATG 7 cut(s) 84, 102, 197, 212, 290, 890, 1075
Ksp22I TGATCA 2 cut(s) 190, 994
Kzo9I GATC 7 cut(s) 190, 271, 348, 412, 962, 968, 994
LmnI GCTCC 1 cut(s) 162
LweI GCATC 2 cut(s) 779, 1045
MaeI CTAG 3 cut(s) 254, 410, 696
MaeII ACGT 1 cut(s) 468
MaeIII GTNAC 4 cut(s) 263, 506, 619, 719
MalI GATC 7 cut(s) 192, 273, 350, 414, 964, 970, 996
MboI GATC 7 cut(s) 190, 271, 348, 412, 962, 968, 994
MboII GAAGA 4 cut(s) 88, 460, 829, 963
MfeI CAATTG 1 cut(s) 1011
MflI RGATCY 3 cut(s) 348, 412, 968
MhlI GDGCHC 1 cut(s) 219
MlsI TGGCCA 1 cut(s) 916
MluNI TGGCCA 1 cut(s) 916
MnlI CCTC 5 cut(s) 425, 429, 738, 802, 812
Mox20I TGGCCA 1 cut(s) 916
MscI TGGCCA 1 cut(s) 916
MseI TTAA 7 cut(s) 231, 570, 594, 750, 764, 870, 947
MslI CAYNNNNRTG 2 cut(s) 662, 987
Msp20I TGGCCA 1 cut(s) 916
MspR9I CCNGG 1 cut(s) 476
MunI CAATTG 1 cut(s) 1011
Mva1269I GAATGC 1 cut(s) 797
MvaI CCWGG 1 cut(s) 476
MwoI GCNNNNNNNGC 1 cut(s) 64
NdeI CATATG 1 cut(s) 919
NdeII GATC 7 cut(s) 190, 271, 348, 412, 962, 968, 994
NlaIII CATG 7 cut(s) 84, 102, 197, 212, 290, 890, 1075
NlaIV GGNNCC 2 cut(s) 217, 339
NmuCI GTSAC 2 cut(s) 263, 719
NspI RCATGY 1 cut(s) 84
PciI ACATGT 1 cut(s) 80
PctI GAATGC 1 cut(s) 797
PfeI GAWTC 1 cut(s) 435
PpuMI RGGWCCY 1 cut(s) 799
PscI ACATGT 1 cut(s) 80
PshBI ATTAAT 1 cut(s) 570
Psp5II RGGWCCY 1 cut(s) 799
Psp6I CCWGG 1 cut(s) 474
PspGI CCWGG 1 cut(s) 474
PspN4I GGNNCC 2 cut(s) 217, 339
PspOMI GGGCCC 1 cut(s) 215
PspPI GGNCC 4 cut(s) 215, 216, 478, 799
PspPPI RGGWCCY 1 cut(s) 799
PsuI RGATCY 3 cut(s) 348, 412, 968
RsaI GTAC 2 cut(s) 198, 780
RsaNI GTAC 2 cut(s) 197, 779
RseI CAYNNNNRTG 2 cut(s) 662, 987
SaqAI TTAA 7 cut(s) 231, 570, 594, 750, 764, 870, 947
Sau3AI GATC 7 cut(s) 190, 271, 348, 412, 962, 968, 994
Sau96I GGNCC 4 cut(s) 215, 216, 478, 799
ScrFI CCNGG 1 cut(s) 476
SduI GDGCHC 1 cut(s) 219
SfaNI GCATC 2 cut(s) 779, 1045
SinI GGWCC 1 cut(s) 799
SmiMI CAYNNNNRTG 2 cut(s) 662, 987
SmlI CTYRAG 2 cut(s) 245, 626
SmoI CTYRAG 2 cut(s) 245, 626
SsiI CCGC 3 cut(s) 103, 851, 878
SspMI CTAG 3 cut(s) 254, 410, 696
StyD4I CCNGG 1 cut(s) 474
TaaI ACNGT 2 cut(s) 512, 859
TaiI ACGT 1 cut(s) 471
TaqI TCGA 4 cut(s) 138, 180, 274, 730
TatI WGTACW 2 cut(s) 196, 778
TfiI GAWTC 1 cut(s) 435
Tru1I TTAA 7 cut(s) 231, 570, 594, 750, 764, 870, 947
Tru9I TTAA 7 cut(s) 231, 570, 594, 750, 764, 870, 947
TscAI CASTG 1 cut(s) 724
TseFI GTSAC 2 cut(s) 263, 719
Tsp45I GTSAC 2 cut(s) 263, 719
TspDTI ATGAA 2 cut(s) 275, 304
TspGWI ACGGA 1 cut(s) 554
TspRI CASTG 1 cut(s) 724
VpaK11BI GGWCC 1 cut(s) 799
VspI ATTAAT 1 cut(s) 570
XagI CCTNNNNNAGG 1 cut(s) 806
XapI RAATTY 3 cut(s) 42, 458, 732
XbaI TCTAGA 1 cut(s) 253
XceI RCATGY 1 cut(s) 84
XmiI GTMKAC 2 cut(s) 36, 107
XspI CTAG 3 cut(s) 254, 410, 696
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.