Rmu_sc0010392.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010392.1
Physical Location & Seq
Reverse (-)
1 .. 303
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010392.1_g000001.1.cds

Sequence Viewer

Length: 159 bp
atgatcagaggtgtcagtgccgaccaagttactgagtggcaagataagtactgggaggctgcagatgagttaggccacaaggagcttggttcagaaaaatcgggacgtgacgcatacggaaatgtttggcgtgaacattggaaagaagctatgtggcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.3

Weight (kDa)

4.95

Isoelectric Point (pI)

5.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030053)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0388691
rosa_multiflora Rmu_sc0010392.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 50
AjiI CACGTC 1 cut(s) 107
AluBI AGCT 2 cut(s) 85, 149
AluI AGCT 2 cut(s) 85, 149
AoxI GGCC 1 cut(s) 73
ApeKI GCWGC 1 cut(s) 59
BbvI GCAGC 1 cut(s) 46
BclI TGATCA 1 cut(s) 3
BfmI CTRYAG 1 cut(s) 60
BisI GCNGC 1 cut(s) 60
BlsI GCNGC 1 cut(s) 61
BmcAI AGTACT 1 cut(s) 50
BmgBI CACGTC 1 cut(s) 107
BmrI ACTGGG 1 cut(s) 61
BmuI ACTGGG 1 cut(s) 61
Bse1I ACTGG 1 cut(s) 56
BseMII CTCAG 1 cut(s) 24
BseNI ACTGG 1 cut(s) 56
BseXI GCAGC 1 cut(s) 46
BshFI GGCC 1 cut(s) 75
BslFI GGGAC 1 cut(s) 117
BsmFI GGGAC 1 cut(s) 117
BsnI GGCC 1 cut(s) 75
Bsp143I GATC 1 cut(s) 3
BspANI GGCC 1 cut(s) 75
BspCNI CTCAG 1 cut(s) 25
BspMAI CTGCAG 1 cut(s) 64
BsrI ACTGG 1 cut(s) 56
BssMI GATC 1 cut(s) 3
BstDEI CTNAG 1 cut(s) 33
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstSFI CTRYAG 1 cut(s) 60
BstV1I GCAGC 1 cut(s) 46
BsuRI GGCC 1 cut(s) 75
BtrI CACGTC 1 cut(s) 107
BtsIMutI CAGTG 1 cut(s) 22
CseI GACGC 1 cut(s) 119
Csp6I GTAC 1 cut(s) 49
CviJI RGCY 4 cut(s) 59, 75, 85, 149
CviKI_1 RGCY 4 cut(s) 59, 75, 85, 149
CviQI GTAC 1 cut(s) 49
DdeI CTNAG 1 cut(s) 33
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
FaiI YATR 2 cut(s) 115, 152
FaqI GGGAC 1 cut(s) 117
FbaI TGATCA 1 cut(s) 3
Fnu4HI GCNGC 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 60
GluI GCNGC 1 cut(s) 60
HaeIII GGCC 1 cut(s) 75
HgaI GACGC 1 cut(s) 119
Hpy166II GTNNAC 1 cut(s) 134
Hpy188I TCNGA 2 cut(s) 8, 94
Hpy188III TCNNGA 1 cut(s) 102
Hpy8I GTNNAC 1 cut(s) 134
HpyCH4IV ACGT 1 cut(s) 106
HpyCH4V TGCA 1 cut(s) 62
HpyF3I CTNAG 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 106
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 1 cut(s) 37
Lsp1109I GCAGC 1 cut(s) 46
MaeII ACGT 1 cut(s) 106
MaeIII GTNAC 2 cut(s) 28, 107
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MnlI CCTC 1 cut(s) 49
NdeII GATC 1 cut(s) 3
NmuCI GTSAC 1 cut(s) 107
PkrI GCNGC 1 cut(s) 61
PstI CTGCAG 1 cut(s) 64
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
SatI GCNGC 1 cut(s) 60
Sau3AI GATC 1 cut(s) 3
ScaI AGTACT 1 cut(s) 50
SetI ASST 4 cut(s) 13, 87, 109, 151
SfcI CTRYAG 1 cut(s) 60
SgeI CNNG 8 cut(s) 38, 53, 64, 91, 98, 114, 119, 143
TaiI ACGT 1 cut(s) 109
TatI WGTACW 1 cut(s) 48
TscAI CASTG 1 cut(s) 22
TseFI GTSAC 1 cut(s) 107
TseI GCWGC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 107
TspGWI ACGGA 1 cut(s) 132
TspRI CASTG 1 cut(s) 22
XcmI CCANNNNNNNNNTGG 1 cut(s) 83
ZrmI AGTACT 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.