Rmu_sc0016934.1_g000003

ATP-dependent zinc metalloprotease FTSH

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016934.1
Physical Location & Seq
Forward (+)
16533 .. 17120
588 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016934.1_g000003.1.cds

Sequence Viewer

Length: 366 bp
atgattttttcaaggattggtcgctccttatctcgatcctctcgctccaggaatttgctttctcggaatgggcgatcggcggcggctgaagggcttttgggagtaccgggttcgggttcgtatctgggtcgggtcgatggggatttagggtttatgaggacctatattgcttcggcaataggagcgcacaagacccatgtttctgatttgagttacattctagggaaccctaaatttgtgagactgttttccagtgaagcccctaagaaaaagaattttgagaacttctatcccaaggaaaagaaagaaatcccaaaagggaatgatcagaaatccgagtccaaaggtaaatcttttttagcttga

Protein Analysis

121

Amino Acids

13.27

Weight (kDa)

10.32

Isoelectric Point (pI)

43.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024679)

Species Orthologous Gene IDs
pyrus_communis pycom11g08200
rosa_multiflora Rmu_sc0016934.1_g000003 Rmu_sc0025019.1_g000004

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 80, 83
AclWI GGATC 1 cut(s) 30
AcsI RAATTY 3 cut(s) 52, 233, 274
AcuI CTGAAG 1 cut(s) 108
AfaI GTAC 1 cut(s) 105
AfiI CCNNNNNNNGG 1 cut(s) 113
AgsI TTSAA 1 cut(s) 12
AjnI CCWGG 1 cut(s) 47
AluBI AGCT 1 cut(s) 362
AluI AGCT 1 cut(s) 362
Alw26I GTCTC 1 cut(s) 235
AlwI GGATC 1 cut(s) 30
ApoI RAATTY 3 cut(s) 52, 233, 274
AspLEI GCGC 1 cut(s) 187
AspS9I GGNCC 1 cut(s) 159
AsuC2I CCSGG 1 cut(s) 108
AvaII GGWCC 1 cut(s) 159
BccI CCATC 1 cut(s) 131
BciT130I CCWGG 1 cut(s) 49
BclI TGATCA 1 cut(s) 325
BcnI CCSGG 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 235
BfaI CTAG 1 cut(s) 221
BisI GCNGC 2 cut(s) 81, 84
BlsI GCNGC 2 cut(s) 82, 85
Bme1390I CCNGG 2 cut(s) 49, 108
Bme18I GGWCC 1 cut(s) 159
BmgT120I GGNCC 1 cut(s) 159
BmiI GGNNCC 1 cut(s) 227
BmrFI CCNGG 2 cut(s) 49, 108
BpmI CTGGAG 1 cut(s) 31
BpuMI CCSGG 1 cut(s) 108
BsaJI CCNNGG 1 cut(s) 294
Bsc4I CCNNNNNNNGG 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 252
BseBI CCWGG 1 cut(s) 49
BseDI CCNNGG 1 cut(s) 294
BseLI CCNNNNNNNGG 1 cut(s) 113
BseNI ACTGG 1 cut(s) 252
Bsh1285I CGRYCG 1 cut(s) 77
BsiEI CGRYCG 1 cut(s) 77
BsiSI CCGG 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 113
BsmAI GTCTC 1 cut(s) 235
Bsp143I GATC 3 cut(s) 35, 74, 325
BspACI CCGC 2 cut(s) 80, 83
BspLI GGNNCC 1 cut(s) 227
BspPI GGATC 1 cut(s) 30
BsrI ACTGG 1 cut(s) 252
BssECI CCNNGG 1 cut(s) 294
BssMI GATC 3 cut(s) 35, 74, 325
BssT1I CCWWGG 1 cut(s) 294
Bst2UI CCWGG 1 cut(s) 49
Bst4CI ACNGT 1 cut(s) 246
BstDEI CTNAG 1 cut(s) 264
BstHHI GCGC 1 cut(s) 187
BstKTI GATC 3 cut(s) 38, 77, 328
BstMAI GTCTC 1 cut(s) 235
BstMBI GATC 3 cut(s) 35, 74, 325
BstMCI CGRYCG 1 cut(s) 77
BstMWI GCNNNNNNNGC 1 cut(s) 182
BstNI CCWGG 1 cut(s) 49
BstSCI CCNGG 2 cut(s) 47, 106
BtsIMutI CAGTG 1 cut(s) 259
CfoI GCGC 1 cut(s) 187
Cfr13I GGNCC 1 cut(s) 159
Csp6I GTAC 1 cut(s) 104
CviAII CATG 1 cut(s) 197
CviJI RGCY 4 cut(s) 86, 94, 260, 362
CviKI_1 RGCY 4 cut(s) 86, 94, 260, 362
CviQI GTAC 1 cut(s) 104
DdeI CTNAG 1 cut(s) 264
DpnI GATC 3 cut(s) 37, 76, 327
DpnII GATC 3 cut(s) 35, 74, 325
Eco130I CCWWGG 1 cut(s) 294
Eco47I GGWCC 1 cut(s) 159
Eco57I CTGAAG 1 cut(s) 108
EcoO109I RGGNCCY 1 cut(s) 159
EcoRII CCWGG 1 cut(s) 47
EcoT14I CCWWGG 1 cut(s) 294
ErhI CCWWGG 1 cut(s) 294
FaeI CATG 1 cut(s) 200
FaiI YATR 3 cut(s) 155, 165, 198
FatI CATG 1 cut(s) 196
FbaI TGATCA 1 cut(s) 325
Fnu4HI GCNGC 2 cut(s) 81, 84
Fsp4HI GCNGC 2 cut(s) 81, 84
FspBI CTAG 1 cut(s) 221
GlaI GCGC 1 cut(s) 186
GluI GCNGC 2 cut(s) 81, 84
GsuI CTGGAG 1 cut(s) 31
HapII CCGG 1 cut(s) 107
HhaI GCGC 1 cut(s) 187
Hin1II CATG 1 cut(s) 200
Hin6I GCGC 1 cut(s) 185
HinP1I GCGC 1 cut(s) 185
HinfI GANTC 1 cut(s) 338
HpaII CCGG 1 cut(s) 107
Hpy188I TCNGA 4 cut(s) 66, 205, 330, 337
Hpy188III TCNNGA 1 cut(s) 33
HpyAV CCTTC 1 cut(s) 83
HpyCH4III ACNGT 1 cut(s) 246
HpyF10VI GCNNNNNNNGC 1 cut(s) 182
HpyF3I CTNAG 1 cut(s) 264
Hsp92II CATG 1 cut(s) 200
HspAI GCGC 1 cut(s) 185
Ksp22I TGATCA 1 cut(s) 325
Kzo9I GATC 3 cut(s) 35, 74, 325
LmnI GCTCC 3 cut(s) 29, 50, 182
LpnPI CCDG 5 cut(s) 34, 61, 110, 120, 265
MaeI CTAG 1 cut(s) 221
MaeIII GTNAC 1 cut(s) 212
MalI GATC 3 cut(s) 37, 76, 327
MboI GATC 3 cut(s) 35, 74, 325
MluCI AATT 3 cut(s) 52, 233, 274
MlyI GAGTC 1 cut(s) 347
MnlI CCTC 2 cut(s) 49, 150
MspI CCGG 1 cut(s) 107
MspR9I CCNGG 2 cut(s) 49, 108
MvaI CCWGG 1 cut(s) 49
MwoI GCNNNNNNNGC 1 cut(s) 182
NciI CCSGG 1 cut(s) 108
NdeII GATC 3 cut(s) 35, 74, 325
NlaIII CATG 1 cut(s) 200
NlaIV GGNNCC 1 cut(s) 227
PcsI WCGNNNNNNNCGW 1 cut(s) 70
PfoI TCCNGGA 1 cut(s) 47
PkrI GCNGC 2 cut(s) 82, 85
Ple19I CGATCG 1 cut(s) 77
PleI GAGTC 1 cut(s) 346
PpsI GAGTC 1 cut(s) 346
PpuMI RGGWCCY 1 cut(s) 159
Psp5II RGGWCCY 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 47
PspGI CCWGG 1 cut(s) 47
PspN4I GGNNCC 1 cut(s) 227
PspPI GGNCC 1 cut(s) 159
PspPPI RGGWCCY 1 cut(s) 159
PvuI CGATCG 1 cut(s) 77
RsaI GTAC 1 cut(s) 105
RsaNI GTAC 1 cut(s) 104
SatI GCNGC 2 cut(s) 81, 84
Sau3AI GATC 3 cut(s) 35, 74, 325
Sau96I GGNCC 1 cut(s) 159
SchI GAGTC 1 cut(s) 347
ScrFI CCNGG 2 cut(s) 49, 108
SetI ASST 3 cut(s) 164, 349, 364
SinI GGWCC 1 cut(s) 159
Sse9I AATT 3 cut(s) 52, 233, 274
SsiI CCGC 2 cut(s) 80, 83
SspMI CTAG 1 cut(s) 221
StyD4I CCNGG 2 cut(s) 47, 106
StyI CCWWGG 1 cut(s) 294
TaaI ACNGT 1 cut(s) 246
TaqI TCGA 2 cut(s) 34, 135
TasI AATT 3 cut(s) 52, 233, 274
TauI GCSGC 2 cut(s) 83, 86
TscAI CASTG 1 cut(s) 259
TspRI CASTG 1 cut(s) 259
VpaK11BI GGWCC 1 cut(s) 159
XapI RAATTY 3 cut(s) 52, 233, 274
XspI CTAG 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.