Rmu_sc0019526.1_g000001

Transmembrane protein 56-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019526.1
Physical Location & Seq
Forward (+)
1 .. 662
662 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019526.1_g000001.1.cds

Sequence Viewer

Length: 189 bp
gttgccagaatccttctgttcatgtttctgttctaccatctctacctgcattatgaacaggtaaaacaaatgcacgccgttggacaatttttagctttcggggtgccaccaatactagctgtcatgaatttgatatggtttgggaagattttgaagggattgaagaagacattagcaaagaggcaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.29

Weight (kDa)

10.29

Isoelectric Point (pI)

51.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029383)

Species Orthologous Gene IDs
pyrus_communis pycom10g19830
rosa_multiflora Rmu_sc0019526.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 54
AccB1I GGYRCC 1 cut(s) 103
AcsI RAATTY 1 cut(s) 127
AgsI TTSAA 2 cut(s) 154, 163
AluBI AGCT 2 cut(s) 95, 119
AluI AGCT 2 cut(s) 95, 119
ApoI RAATTY 1 cut(s) 127
BanI GGYRCC 1 cut(s) 103
BbsI GAAGAC 1 cut(s) 173
BccI CCATC 1 cut(s) 45
BceAI ACGGC 1 cut(s) 62
BfaI CTAG 1 cut(s) 116
BfuAI ACCTGC 1 cut(s) 54
BmiI GGNNCC 1 cut(s) 105
BpiI GAAGAC 1 cut(s) 173
BshNI GGYRCC 1 cut(s) 103
BspHI TCATGA 1 cut(s) 123
BspLI GGNNCC 1 cut(s) 105
BspMI ACCTGC 1 cut(s) 54
BspT107I GGYRCC 1 cut(s) 103
BstC8I GCNNGC 1 cut(s) 75
BstV2I GAAGAC 1 cut(s) 173
BveI ACCTGC 1 cut(s) 54
Cac8I GCNNGC 1 cut(s) 75
CciI TCATGA 1 cut(s) 123
CviAII CATG 2 cut(s) 22, 124
CviJI RGCY 2 cut(s) 95, 119
CviKI_1 RGCY 2 cut(s) 95, 119
FaeI CATG 2 cut(s) 25, 127
FaiI YATR 4 cut(s) 23, 54, 125, 136
FatI CATG 2 cut(s) 21, 123
FspBI CTAG 1 cut(s) 116
Hin1II CATG 2 cut(s) 25, 127
HinfI GANTC 1 cut(s) 9
Hpy188III TCNNGA 1 cut(s) 124
HpyAV CCTTC 2 cut(s) 23, 148
HpyCH4V TGCA 2 cut(s) 49, 73
Hsp92II CATG 2 cut(s) 25, 127
LpnPI CCDG 3 cut(s) 19, 44, 59
MaeI CTAG 1 cut(s) 116
MboII GAAGA 3 cut(s) 157, 175, 178
MluCI AATT 2 cut(s) 86, 127
MmeI TCCRAC 1 cut(s) 61
MnlI CCTC 1 cut(s) 174
NlaIII CATG 2 cut(s) 25, 127
NlaIV GGNNCC 1 cut(s) 105
PagI TCATGA 1 cut(s) 123
PfeI GAWTC 1 cut(s) 9
PspN4I GGNNCC 1 cut(s) 105
SetI ASST 4 cut(s) 48, 63, 97, 121
SgeI CNNG 8 cut(s) 18, 34, 58, 71, 86, 112, 128, 136
Sse9I AATT 2 cut(s) 86, 127
SspMI CTAG 1 cut(s) 116
TasI AATT 2 cut(s) 86, 127
TfiI GAWTC 1 cut(s) 9
TspDTI ATGAA 3 cut(s) 10, 69, 140
XapI RAATTY 1 cut(s) 127
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.