Rmu_sc0022734.1_g000001

amidase C869.01

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022734.1
Physical Location & Seq
Reverse (-)
2236 .. 2535
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022734.1_g000001.1.cds

Sequence Viewer

Length: 300 bp
atgggaccaaaagagcaggaggcattgtcaaatttagaaagactatctagacaggggttcaagaagttgatgaccgatcatagcctagatgccttggtggcttatgctaacagtgcttctagtatcctcgcaattggtggttttccgggcattgttgtgccggcaggatatcataacactaaaaagtatccttttgggatctgctttgggggactcaagggttcagagccaaagctgattgagatcgcctatgcctttgagcaagcaactaagatgaggagaaagcctcctctagcctga
Functional Annotation

Protein Analysis

99

Amino Acids

10.74

Weight (kDa)

9.52

Isoelectric Point (pI)

53.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024667)

Species Orthologous Gene IDs
pyrus_communis pycom10g10390
rosa_multiflora Rmu_sc0007349.1_g000002 Rmu_sc0022734.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 206
AcsI RAATTY 1 cut(s) 31
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 1 cut(s) 235
AluI AGCT 1 cut(s) 235
AlwI GGATC 1 cut(s) 206
ApoI RAATTY 1 cut(s) 31
AspS9I GGNCC 1 cut(s) 5
AsuC2I CCSGG 1 cut(s) 147
AvaII GGWCC 1 cut(s) 5
BciVI GTATCC 2 cut(s) 134, 198
BcnI CCSGG 1 cut(s) 147
BfaI CTAG 4 cut(s) 48, 86, 120, 293
BfuI GTATCC 2 cut(s) 134, 198
BglI GCCNNNNNGGC 1 cut(s) 98
Bme1390I CCNGG 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 1 cut(s) 5
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 147
BmsI GCATC 1 cut(s) 79
BplI GAGNNNNNCTC 1 cut(s) 271
BpuEI CTTGAG 1 cut(s) 200
BpuMI CCSGG 1 cut(s) 147
BsaBI GATNNNNATC 1 cut(s) 242
BsaJI CCNNGG 1 cut(s) 93
BsaXI ACNNNNNCTCC 2 cut(s) 11, 41
Bse118I RCCGGY 1 cut(s) 160
Bse8I GATNNNNATC 1 cut(s) 242
BseDI CCNNGG 1 cut(s) 93
BseJI GATNNNNATC 1 cut(s) 242
BseRI GAGGAG 2 cut(s) 279, 292
BsiSI CCGG 2 cut(s) 146, 161
BslFI GGGAC 2 cut(s) 18, 225
BsmFI GGGAC 2 cut(s) 18, 225
Bsp143I GATC 3 cut(s) 76, 198, 243
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 206
BsrFI RCCGGY 1 cut(s) 160
BssAI RCCGGY 1 cut(s) 160
BssECI CCNNGG 1 cut(s) 93
BssMI GATC 3 cut(s) 76, 198, 243
BssT1I CCWWGG 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 113
BstC8I GCNNGC 2 cut(s) 162, 264
BstDEI CTNAG 1 cut(s) 270
BstKTI GATC 3 cut(s) 79, 201, 246
BstMBI GATC 3 cut(s) 76, 198, 243
BstMWI GCNNNNNNNGC 2 cut(s) 98, 113
BstSCI CCNGG 1 cut(s) 145
BstX2I RGATCY 1 cut(s) 198
BstYI RGATCY 1 cut(s) 198
BsuI GTATCC 2 cut(s) 134, 198
BtsIMutI CAGTG 1 cut(s) 118
Cac8I GCNNGC 2 cut(s) 162, 264
Cfr10I RCCGGY 1 cut(s) 160
Cfr13I GGNCC 1 cut(s) 5
CviJI RGCY 6 cut(s) 84, 101, 229, 235, 286, 296
CviKI_1 RGCY 6 cut(s) 84, 101, 229, 235, 286, 296
DdeI CTNAG 1 cut(s) 270
DpnI GATC 3 cut(s) 78, 200, 245
DpnII GATC 3 cut(s) 76, 198, 243
Eco130I CCWWGG 1 cut(s) 93
Eco32I GATATC 1 cut(s) 170
Eco47I GGWCC 1 cut(s) 5
EcoRV GATATC 1 cut(s) 170
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaiI YATR 4 cut(s) 81, 105, 174, 252
FaqI GGGAC 2 cut(s) 18, 225
FspBI CTAG 4 cut(s) 48, 86, 120, 293
HapII CCGG 2 cut(s) 146, 161
HinfI GANTC 1 cut(s) 213
HpaII CCGG 2 cut(s) 146, 161
Hpy188I TCNGA 1 cut(s) 226
Hpy188III TCNNGA 2 cut(s) 48, 61
HpyCH4III ACNGT 1 cut(s) 113
HpyF10VI GCNNNNNNNGC 2 cut(s) 98, 113
HpyF3I CTNAG 1 cut(s) 270
KroI GCCGGC 1 cut(s) 160
KroNI GCCGGC 1 cut(s) 162
Kzo9I GATC 3 cut(s) 76, 198, 243
LpnPI CCDG 5 cut(s) 2, 38, 150, 159, 174
LweI GCATC 1 cut(s) 79
MaeI CTAG 4 cut(s) 48, 86, 120, 293
MalI GATC 3 cut(s) 78, 200, 245
MboI GATC 3 cut(s) 76, 198, 243
MfeI CAATTG 1 cut(s) 132
MflI RGATCY 1 cut(s) 198
MluCI AATT 2 cut(s) 31, 132
MlyI GAGTC 1 cut(s) 207
MnlI CCTC 5 cut(s) 13, 137, 270, 297, 300
MroNI GCCGGC 1 cut(s) 160
MslI CAYNNNNRTG 1 cut(s) 155
MspI CCGG 2 cut(s) 146, 161
MspR9I CCNGG 1 cut(s) 147
MunI CAATTG 1 cut(s) 132
MwoI GCNNNNNNNGC 2 cut(s) 98, 113
NaeI GCCGGC 1 cut(s) 162
NciI CCSGG 1 cut(s) 147
NdeII GATC 3 cut(s) 76, 198, 243
NgoMIV GCCGGC 1 cut(s) 160
NlaIV GGNNCC 1 cut(s) 6
PdiI GCCGGC 1 cut(s) 162
PleI GAGTC 1 cut(s) 207
PpsI GAGTC 1 cut(s) 207
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 5
PsuI RGATCY 1 cut(s) 198
RseI CAYNNNNRTG 1 cut(s) 155
Sau3AI GATC 3 cut(s) 76, 198, 243
Sau96I GGNCC 1 cut(s) 5
SchI GAGTC 1 cut(s) 207
ScrFI CCNGG 1 cut(s) 147
SetI ASST 1 cut(s) 237
SfaNI GCATC 1 cut(s) 79
SinI GGWCC 1 cut(s) 5
SmiMI CAYNNNNRTG 1 cut(s) 155
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 2 cut(s) 31, 132
SspMI CTAG 4 cut(s) 48, 86, 120, 293
StyD4I CCNGG 1 cut(s) 145
StyI CCWWGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 113
TaqII GACCGA 1 cut(s) 89
TasI AATT 2 cut(s) 31, 132
TscAI CASTG 1 cut(s) 118
TspRI CASTG 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 5
XapI RAATTY 1 cut(s) 31
XbaI TCTAGA 1 cut(s) 47
XspI CTAG 4 cut(s) 48, 86, 120, 293
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.