Rmu_sc0033683.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033683.1
OG0031033
Physical Location & Seq
Reverse (-)
1 .. 1000
1000 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033683.1_g000001.1.cds

Sequence Viewer

Length: 559 bp
aaaccaccgccgcccaccttgaagatctcaactccaggattccagaaccggcggccccgcccccagaacgggccggaaaatatccgaaccggccaccgaaaatatctatatcctccctgccaggttcgaagctttcctccctgcctactactaccaaacttcactggaaactgcacccagaccctagatcaccggagccgaaaaatctccaccggaacggcctagaaccatccgaatcggccaccagaaaagactgcaaccgaaccggcagaaagaagaaagaaaaaaaaaaggaggcagaagccgagcccaagccaagcactgaagcccagcaacgcggcccactgacgtcagctgccacgtcagcatccacgcaagcacacgtcagcatccagtcggacctgccacgtcagcgccgcactgccacgtcaacttcgacctgccacgtcagcacccccggtcaacgccggtcaacactttttaggcgacttttccggccactttccagcgacatttttccgaccaactttcggtcaagttttccggccatctttctaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

185

Amino Acids

20.46

Weight (kDa)

10.65

Isoelectric Point (pI)

59.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031033)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000060.1_g000035 Rmu_sc0033683.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 352
Acc36I ACCTGC 2 cut(s) 410, 448
AccII CGCG 1 cut(s) 338
AciI CCGC 6 cut(s) 8, 11, 52, 58, 338, 417
AcoI YGGCCR 4 cut(s) 91, 239, 496, 545
AcuI CTGAAG 1 cut(s) 344
AcyI GRCGYC 1 cut(s) 349
AfiI CCNNNNNNNGG 3 cut(s) 68, 69, 530
AflIII ACRYGT 1 cut(s) 381
AgsI TTSAA 1 cut(s) 22
AjiI CACGTC 5 cut(s) 362, 384, 409, 428, 447
AjnI CCWGG 2 cut(s) 34, 120
AluBI AGCT 2 cut(s) 132, 355
AluI AGCT 2 cut(s) 132, 355
AoxI GGCC 8 cut(s) 53, 71, 91, 219, 239, 339, 496, 545
ApeKI GCWGC 1 cut(s) 355
AspLEI GCGC 1 cut(s) 416
AspS9I GGNCC 4 cut(s) 54, 71, 340, 399
AsuC2I CCSGG 1 cut(s) 458
AsuHPI GGTGA 1 cut(s) 182
AsuII TTCGAA 1 cut(s) 127
AvaII GGWCC 1 cut(s) 399
BanII GRGCYC 1 cut(s) 311
BbvI GCAGC 1 cut(s) 342
BccI CCATC 2 cut(s) 237, 556
BceAI ACGGC 1 cut(s) 234
BciT130I CCWGG 2 cut(s) 36, 122
BcnI CCSGG 1 cut(s) 458
BfaI CTAG 2 cut(s) 185, 223
BfoI RGCGCY 1 cut(s) 417
BfuAI ACCTGC 2 cut(s) 410, 448
BglII AGATCT 1 cut(s) 24
BisI GCNGC 5 cut(s) 11, 53, 339, 356, 417
BlsI GCNGC 5 cut(s) 12, 54, 340, 357, 418
Bme1390I CCNGG 3 cut(s) 36, 122, 458
Bme18I GGWCC 1 cut(s) 399
BmgBI CACGTC 5 cut(s) 362, 384, 409, 428, 447
BmgT120I GGNCC 4 cut(s) 54, 71, 340, 399
BmiI GGNNCC 2 cut(s) 56, 197
BmrFI CCNGG 3 cut(s) 36, 122, 458
BmsI GCATC 2 cut(s) 376, 398
BpmI CTGGAG 1 cut(s) 18
Bpu14I TTCGAA 1 cut(s) 127
BpuMI CCSGG 1 cut(s) 458
BsaHI GRCGYC 1 cut(s) 349
BsaJI CCNNGG 1 cut(s) 456
BsaWI WCCGGW 2 cut(s) 192, 212
Bsc4I CCNNNNNNNGG 3 cut(s) 68, 69, 530
Bse118I RCCGGY 4 cut(s) 48, 89, 265, 467
Bse1I ACTGG 2 cut(s) 169, 393
BseBI CCWGG 2 cut(s) 36, 122
BseDI CCNNGG 1 cut(s) 456
BseGI GGATG 3 cut(s) 229, 367, 389
BseLI CCNNNNNNNGG 3 cut(s) 68, 69, 530
BseNI ACTGG 2 cut(s) 169, 393
BseXI GCAGC 1 cut(s) 342
BseYI CCCAGC 1 cut(s) 329
BsgI GTGCAG 1 cut(s) 157
Bsh1236I CGCG 1 cut(s) 338
BshFI GGCC 8 cut(s) 55, 73, 93, 221, 241, 341, 498, 547
BslI CCNNNNNNNGG 3 cut(s) 68, 69, 530
BsnI GGCC 8 cut(s) 55, 73, 93, 221, 241, 341, 498, 547
Bsp119I TTCGAA 1 cut(s) 127
Bsp1286I GDGCHC 1 cut(s) 311
Bsp143I GATC 2 cut(s) 24, 187
BspACI CCGC 6 cut(s) 8, 11, 52, 58, 338, 417
BspANI GGCC 8 cut(s) 55, 73, 93, 221, 241, 341, 498, 547
BspFNI CGCG 1 cut(s) 338
BspLI GGNNCC 2 cut(s) 56, 197
BspMI ACCTGC 2 cut(s) 410, 448
BspT104I TTCGAA 1 cut(s) 127
BsrFI RCCGGY 4 cut(s) 48, 89, 265, 467
BsrI ACTGG 2 cut(s) 169, 393
BssAI RCCGGY 4 cut(s) 48, 89, 265, 467
BssECI CCNNGG 1 cut(s) 456
BssMI GATC 2 cut(s) 24, 187
BssNI GRCGYC 1 cut(s) 349
Bst2UI CCWGG 2 cut(s) 36, 122
BstACI GRCGYC 1 cut(s) 349
BstBI TTCGAA 1 cut(s) 127
BstC8I GCNNGC 1 cut(s) 377
BstDEI CTNAG 1 cut(s) 556
BstF5I GGATG 3 cut(s) 229, 367, 389
BstFNI CGCG 1 cut(s) 338
BstH2I RGCGCY 1 cut(s) 417
BstHHI GCGC 1 cut(s) 416
BstKTI GATC 2 cut(s) 27, 190
BstMBI GATC 2 cut(s) 24, 187
BstMWI GCNNNNNNNGC 3 cut(s) 364, 411, 449
BstNI CCWGG 2 cut(s) 36, 122
BstSCI CCNGG 3 cut(s) 34, 120, 456
BstUI CGCG 1 cut(s) 338
BstV1I GCAGC 1 cut(s) 342
BstX2I RGATCY 1 cut(s) 24
BstYI RGATCY 1 cut(s) 24
BsuRI GGCC 8 cut(s) 55, 73, 93, 221, 241, 341, 498, 547
BtrI CACGTC 5 cut(s) 362, 384, 409, 428, 447
BtsCI GGATG 3 cut(s) 229, 367, 389
BtsI GCAGTG 1 cut(s) 419
BtsIMutI CAGTG 4 cut(s) 162, 320, 343, 419
BveI ACCTGC 2 cut(s) 410, 448
Cac8I GCNNGC 1 cut(s) 377
CfoI GCGC 1 cut(s) 416
Cfr10I RCCGGY 4 cut(s) 48, 89, 265, 467
Cfr13I GGNCC 4 cut(s) 54, 71, 340, 399
DdeI CTNAG 1 cut(s) 556
DpnI GATC 2 cut(s) 26, 189
DpnII GATC 2 cut(s) 24, 187
EaeI YGGCCR 4 cut(s) 91, 239, 496, 545
Eco24I GRGCYC 1 cut(s) 311
Eco47I GGWCC 1 cut(s) 399
Eco57I CTGAAG 1 cut(s) 344
EcoRII CCWGG 2 cut(s) 34, 120
EcoT38I GRGCYC 1 cut(s) 311
FaiI YATR 1 cut(s) 109
FauI CCCGC 1 cut(s) 65
Fnu4HI GCNGC 5 cut(s) 11, 53, 339, 356, 417
FokI GGATG 3 cut(s) 216, 354, 376
FriOI GRGCYC 1 cut(s) 311
Fsp4HI GCNGC 5 cut(s) 11, 53, 339, 356, 417
FspBI CTAG 2 cut(s) 185, 223
GlaI GCGC 1 cut(s) 415
GluI GCNGC 5 cut(s) 11, 53, 339, 356, 417
GsaI CCCAGC 1 cut(s) 333
GsuI CTGGAG 1 cut(s) 18
HaeII RGCGCY 1 cut(s) 417
HaeIII GGCC 8 cut(s) 55, 73, 93, 221, 241, 341, 498, 547
HhaI GCGC 1 cut(s) 416
Hin1I GRCGYC 1 cut(s) 349
Hin6I GCGC 1 cut(s) 414
HinP1I GCGC 1 cut(s) 414
HincII GTYRAC 3 cut(s) 431, 463, 473
HindII GTYRAC 3 cut(s) 431, 463, 473
HindIII AAGCTT 1 cut(s) 130
HinfI GANTC 2 cut(s) 39, 235
HphI GGTGA 1 cut(s) 182
Hpy166II GTNNAC 3 cut(s) 431, 463, 473
Hpy188I TCNGA 4 cut(s) 86, 234, 399, 521
Hpy188III TCNNGA 1 cut(s) 43
Hpy8I GTNNAC 3 cut(s) 431, 463, 473
HpyCH4IV ACGT 6 cut(s) 349, 361, 383, 408, 427, 446
HpyCH4V TGCA 2 cut(s) 174, 257
HpyF10VI GCNNNNNNNGC 3 cut(s) 364, 411, 449
HpyF3I CTNAG 1 cut(s) 556
HpySE526I ACGT 6 cut(s) 349, 361, 383, 408, 427, 446
Hsp92I GRCGYC 1 cut(s) 349
HspAI GCGC 1 cut(s) 414
Kzo9I GATC 2 cut(s) 24, 187
LmnI GCTCC 1 cut(s) 195
Lsp1109I GCAGC 1 cut(s) 342
LweI GCATC 2 cut(s) 376, 398
MaeI CTAG 2 cut(s) 185, 223
MaeII ACGT 6 cut(s) 349, 361, 383, 408, 427, 446
MalI GATC 2 cut(s) 26, 189
MboI GATC 2 cut(s) 24, 187
MboII GAAGA 2 cut(s) 34, 288
MflI RGATCY 1 cut(s) 24
MhlI GDGCHC 1 cut(s) 311
MmeI TCCRAC 2 cut(s) 377, 544
MnlI CCTC 3 cut(s) 123, 147, 288
MspA1I CMGCKG 1 cut(s) 355
MspR9I CCNGG 3 cut(s) 36, 122, 458
MvaI CCWGG 2 cut(s) 36, 122
MvnI CGCG 1 cut(s) 338
MwoI GCNNNNNNNGC 3 cut(s) 364, 411, 449
NciI CCSGG 1 cut(s) 458
NdeII GATC 2 cut(s) 24, 187
NlaIV GGNNCC 2 cut(s) 56, 197
NmeAIII GCCGAG 1 cut(s) 330
NspV TTCGAA 1 cut(s) 127
PcsI WCGNNNNNNNCGW 1 cut(s) 433
PfeI GAWTC 2 cut(s) 39, 235
PfoI TCCNGGA 1 cut(s) 34
PkrI GCNGC 5 cut(s) 12, 54, 340, 357, 418
Psp6I CCWGG 2 cut(s) 34, 120
PspFI CCCAGC 1 cut(s) 329
PspGI CCWGG 2 cut(s) 34, 120
PspN4I GGNNCC 2 cut(s) 56, 197
PspPI GGNCC 4 cut(s) 54, 71, 340, 399
PsuI RGATCY 1 cut(s) 24
PvuII CAGCTG 1 cut(s) 355
SatI GCNGC 5 cut(s) 11, 53, 339, 356, 417
Sau3AI GATC 2 cut(s) 24, 187
Sau96I GGNCC 4 cut(s) 54, 71, 340, 399
ScrFI CCNGG 3 cut(s) 36, 122, 458
SduI GDGCHC 1 cut(s) 311
SfaNI GCATC 2 cut(s) 376, 398
SfuI TTCGAA 1 cut(s) 127
SinI GGWCC 1 cut(s) 399
SsiI CCGC 6 cut(s) 8, 11, 52, 58, 338, 417
SspMI CTAG 2 cut(s) 185, 223
StyD4I CCNGG 3 cut(s) 34, 120, 456
TaiI ACGT 6 cut(s) 352, 364, 386, 411, 430, 449
TaqI TCGA 2 cut(s) 127, 436
TaqII GACCGA 1 cut(s) 521
TauI GCSGC 4 cut(s) 13, 55, 341, 419
TfiI GAWTC 2 cut(s) 39, 235
TscAI CASTG 4 cut(s) 169, 327, 350, 426
TseI GCWGC 1 cut(s) 355
TspRI CASTG 4 cut(s) 169, 327, 350, 426
VpaK11BI GGWCC 1 cut(s) 399
XspI CTAG 2 cut(s) 185, 223
ZraI GACGTC 1 cut(s) 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.