Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0039864.1

Orthogroup ID

OG0029378

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 293

Gene Structure 293 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0039864.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 186 bp

atggccttctccgagtaccagcaactgaacgacaagttgctcctagactacataaaggccacaccttccctctcttccaagctcaaagaccacctcgacaacttgaccatcaaggaagtcggcgatggcaatctcaattttgtcttcatcgtcgttggttctcatggctcttttgtcatcaagcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000096 GO:0000097 GO:0000302 GO:0003674 GO:0003824 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006082 GO:0006520 GO:0006555 GO:0006790 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0006979 GO:0008150 GO:0008152 GO:0008652 GO:0009058 GO:0009066 GO:0009067 GO:0009086 GO:0009719 GO:0009723 GO:0009725 GO:0009987 GO:0010033 GO:0010035 GO:0010038 GO:0010039 GO:0016053 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0017144 GO:0019509 GO:0019752 GO:0032870 GO:0033554 GO:0034599 GO:0034614 GO:0035690 GO:0042221 GO:0042493 GO:0042802 GO:0043094 GO:0043102 GO:0043436 GO:0044237 GO:0044238 GO:0044249 GO:0044272 GO:0044281 GO:0044283 GO:0044424 GO:0044444 GO:0044464 GO:0046394 GO:0046522 GO:0050896 GO:0051716 GO:0070887 GO:0071241 GO:0071248 GO:0071265 GO:0071267 GO:0071281 GO:0071310 GO:0071369 GO:0071495 GO:0071704 GO:0071731 GO:0071732 GO:0097366 GO:1901564 GO:1901566 GO:1901576 GO:1901605 GO:1901607 GO:1901698 GO:1901699 GO:1901700 GO:1901701 GO:1902170

KEGG Pathways

Metabolic & Signaling

ko00270 ko01100 map00270 map01100

Pfam Domains

Protein Families

APH

Protein Analysis

62

Amino Acids

6.94

Weight (kDa)

6.0

Isoelectric Point (pI)

8.91

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029378)

Species	Orthologous Gene IDs
pyrus_communis	pycom10g08460
rosa_multiflora	Rmu_sc0039864.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	17
AluBI	AGCT	1 cut(s)	82
AluI	AGCT	1 cut(s)	82
AlwNI	CAGNNNCTG	1 cut(s)	25
AoxI	GGCC	2 cut(s)	3, 57
BbsI	GAAGAC	1 cut(s)	136
BccI	CCATC	2 cut(s)	116, 119
BfaI	CTAG	1 cut(s)	44
BpiI	GAAGAC	1 cut(s)	136
BsaBI	GATNNNNATC	1 cut(s)	129
Bse8I	GATNNNNATC	1 cut(s)	129
BseJI	GATNNNNATC	1 cut(s)	129
BshFI	GGCC	2 cut(s)	5, 59
BsnI	GGCC	2 cut(s)	5, 59
BspANI	GGCC	2 cut(s)	5, 59
Bst6I	CTCTTC	1 cut(s)	79
BstV2I	GAAGAC	1 cut(s)	136
BsuRI	GGCC	2 cut(s)	5, 59
BtgZI	GCGATG	1 cut(s)	138
CaiI	CAGNNNCTG	1 cut(s)	25
Csp6I	GTAC	1 cut(s)	16
CviAII	CATG	1 cut(s)	164
CviJI	RGCY	4 cut(s)	5, 59, 82, 168
CviKI_1	RGCY	4 cut(s)	5, 59, 82, 168
CviQI	GTAC	1 cut(s)	16
Eam1104I	CTCTTC	1 cut(s)	79
EarI	CTCTTC	1 cut(s)	79
FaeI	CATG	1 cut(s)	167
FaiI	YATR	2 cut(s)	53, 165
FatI	CATG	1 cut(s)	163
FspBI	CTAG	1 cut(s)	44
HaeIII	GGCC	2 cut(s)	5, 59
Hin1II	CATG	1 cut(s)	167
Hpy188I	TCNGA	1 cut(s)	13
Hpy99I	CGWCG	1 cut(s)	155
HpyAV	CCTTC	2 cut(s)	16, 75
Hsp92II	CATG	1 cut(s)	167
LmnI	GCTCC	1 cut(s)	45
LpnPI	CCDG	1 cut(s)	32
MaeI	CTAG	1 cut(s)	44
MboII	GAAGA	2 cut(s)	66, 136
MluCI	AATT	1 cut(s)	136
MnlI	CCTC	2 cut(s)	80, 104
NlaIII	CATG	1 cut(s)	167
PstNI	CAGNNNCTG	1 cut(s)	25
RsaI	GTAC	1 cut(s)	17
RsaNI	GTAC	1 cut(s)	16
SetI	ASST	3 cut(s)	67, 84, 96
SgeI	CNNG	9 cut(s)	25, 31, 46, 56, 91, 107, 115, 124, 176
Sse9I	AATT	1 cut(s)	136
SspMI	CTAG	1 cut(s)	44
TaqI	TCGA	1 cut(s)	96
TasI	AATT	1 cut(s)	136
TspDTI	ATGAA	1 cut(s)	136
XspI	CTAG	1 cut(s)	44

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.