Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0040047.1

Orthogroup ID

OG0031385

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 805

Gene Structure 805 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0040047.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 219 bp

gatctctcagtcatgaagccagggaagcattcctctcaattttggtttcagatggtcgtgcagaatggttagataaaaggcataggaaatgtctaatcctctggcacaggattcaagagtgggctaacataattctgaacttcgtaaaagaaaatggattggaggacagcgttatgactgttgaggaaatacgttctgggatagaatcaagaggaacag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000814 GO:0003674 GO:0005198 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0006508 GO:0006511 GO:0006807 GO:0006810 GO:0006886 GO:0007034 GO:0008104 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009987 GO:0010008 GO:0012505 GO:0015031 GO:0015833 GO:0016020 GO:0016192 GO:0016197 GO:0019538 GO:0019941 GO:0030163 GO:0031090 GO:0031410 GO:0031982 GO:0032509 GO:0032511 GO:0032991 GO:0033036 GO:0033365 GO:0034613 GO:0036452 GO:0042802 GO:0042803 GO:0042886 GO:0043162 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043328 GO:0043632 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044422 GO:0044424 GO:0044425 GO:0044433 GO:0044440 GO:0044444 GO:0044446 GO:0044464 GO:0045184 GO:0045324 GO:0046907 GO:0046983 GO:0051179 GO:0051234 GO:0051603 GO:0051641 GO:0051649 GO:0070727 GO:0071702 GO:0071704 GO:0071705 GO:0071985 GO:0072594 GO:0072665 GO:0072666 GO:0097708 GO:0098588 GO:0098796 GO:0098805 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

ko04144 map04144

Pfam Domains

Protein Families

ESCRT-II

Protein Analysis

72

Amino Acids

8.39

Weight (kDa)

5.87

Isoelectric Point (pI)

58.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031385)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0007204.1_g000002 Rmu_sc0040047.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	115
AjnI	CCWGG	1 cut(s)	19
BccI	CCATC	1 cut(s)	46
BciT130I	CCWGG	1 cut(s)	21
Bme1390I	CCNGG	1 cut(s)	21
BmrFI	CCNGG	1 cut(s)	21
BsaJI	CCNNGG	1 cut(s)	20
BseBI	CCWGG	1 cut(s)	21
BseDI	CCNNGG	1 cut(s)	20
BseMII	CTCAG	1 cut(s)	21
BsgI	GTGCAG	1 cut(s)	80
BsmI	GAATGC	1 cut(s)	28
BspCNI	CTCAG	1 cut(s)	20
BspHI	TCATGA	1 cut(s)	12
BssECI	CCNNGG	1 cut(s)	20
Bst2UI	CCWGG	1 cut(s)	21
Bst4CI	ACNGT	1 cut(s)	180
BstDEI	CTNAG	1 cut(s)	7
BstKTI	GATC	1 cut(s)	4
BstMWI	GCNNNNNNNGC	1 cut(s)	25
BstNI	CCWGG	1 cut(s)	21
BstSCI	CCNGG	1 cut(s)	19
CciI	TCATGA	1 cut(s)	12
CviAII	CATG	1 cut(s)	13
CviJI	RGCY	2 cut(s)	19, 124
CviKI_1	RGCY	2 cut(s)	19, 124
DdeI	CTNAG	1 cut(s)	7
DpnI	GATC	1 cut(s)	3
EcoRII	CCWGG	1 cut(s)	19
FaeI	CATG	1 cut(s)	16
FaiI	YATR	4 cut(s)	14, 83, 130, 175
FatI	CATG	1 cut(s)	12
Hin1II	CATG	1 cut(s)	16
HinfI	GANTC	2 cut(s)	111, 205
Hpy188I	TCNGA	2 cut(s)	51, 137
Hpy188III	TCNNGA	3 cut(s)	13, 115, 209
HpyCH4III	ACNGT	1 cut(s)	180
HpyCH4IV	ACGT	1 cut(s)	192
HpyCH4V	TGCA	1 cut(s)	61
HpyF10VI	GCNNNNNNNGC	1 cut(s)	25
HpyF3I	CTNAG	1 cut(s)	7
HpySE526I	ACGT	1 cut(s)	192
Hsp92II	CATG	1 cut(s)	16
LpnPI	CCDG	5 cut(s)	6, 33, 87, 93, 182
MaeII	ACGT	1 cut(s)	192
MalI	GATC	1 cut(s)	3
MluCI	AATT	2 cut(s)	38, 131
MnlI	CCTC	5 cut(s)	43, 109, 156, 177, 205
MspR9I	CCNGG	1 cut(s)	21
Mva1269I	GAATGC	1 cut(s)	28
MvaI	CCWGG	1 cut(s)	21
MwoI	GCNNNNNNNGC	1 cut(s)	25
NlaIII	CATG	1 cut(s)	16
PagI	TCATGA	1 cut(s)	12
PctI	GAATGC	1 cut(s)	28
PfeI	GAWTC	2 cut(s)	111, 205
Psp6I	CCWGG	1 cut(s)	19
PspGI	CCWGG	1 cut(s)	19
ScrFI	CCNGG	1 cut(s)	21
SetI	ASST	1 cut(s)	195
SgeI	CNNG	8 cut(s)	25, 32, 33, 70, 114, 120, 127, 209
Sse9I	AATT	2 cut(s)	38, 131
StyD4I	CCNGG	1 cut(s)	19
TaaI	ACNGT	1 cut(s)	180
TaiI	ACGT	1 cut(s)	195
TasI	AATT	2 cut(s)	38, 131
TfiI	GAWTC	2 cut(s)	111, 205
TspDTI	ATGAA	1 cut(s)	29

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.