Rmu_sc0040221.1_g000001

Plant protein of unknown function (DUF639)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040221.1
OG0031009
Physical Location & Seq
Forward (+)
1 .. 2213
2213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040221.1_g000001.1.cds

Sequence Viewer

Length: 231 bp
gcatcggacaagattgttatactgctggttttcatggcagcaatgtttgcattcgtgcctccacgatatataatcctgctagtatttctggaggcttttacaagggaaatgccatataggaaagaaagcagtgacaggtgggtgaggcggattagagaatggtggattcgcataccagcagctcctgtccagctcatcaaacctgaggataacaagaaaaagaaatcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF639

Protein Analysis

76

Amino Acids

9.12

Weight (kDa)

10.27

Isoelectric Point (pI)

48.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031009)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0040221.1_g000001 Rmu_ssc0000178.1_g000014

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 148
AluBI AGCT 2 cut(s) 182, 193
AluI AGCT 2 cut(s) 182, 193
AlwNI CAGNNNCTG 1 cut(s) 185
ApeKI GCWGC 2 cut(s) 38, 179
AsuHPI GGTGA 1 cut(s) 154
AxyI CCTNAGG 1 cut(s) 204
BbvI GCAGC 2 cut(s) 50, 191
BfaI CTAG 1 cut(s) 80
BisI GCNGC 2 cut(s) 39, 180
BlsI GCNGC 2 cut(s) 40, 181
BmsI GCATC 1 cut(s) 11
BpmI CTGGAG 1 cut(s) 110
Bse21I CCTNAGG 1 cut(s) 204
Bse3DI GCAATG 1 cut(s) 48
BseMI GCAATG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 195
BseXI GCAGC 2 cut(s) 50, 191
BsmI GAATGC 1 cut(s) 50
BspACI CCGC 1 cut(s) 148
BspCNI CTCAG 1 cut(s) 196
BsrDI GCAATG 1 cut(s) 48
BstAPI GCANNNNNTGC 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 204
BstMWI GCNNNNNNNGC 1 cut(s) 47
BstV1I GCAGC 2 cut(s) 50, 191
Bsu36I CCTNAGG 1 cut(s) 204
BtsI GCAGTG 1 cut(s) 136
BtsIMutI CAGTG 1 cut(s) 136
CaiI CAGNNNCTG 1 cut(s) 185
CviAII CATG 1 cut(s) 34
CviJI RGCY 3 cut(s) 95, 182, 193
CviKI_1 RGCY 3 cut(s) 95, 182, 193
DdeI CTNAG 1 cut(s) 204
EciI GGCGGA 1 cut(s) 163
Eco81I CCTNAGG 1 cut(s) 204
FaeI CATG 1 cut(s) 37
FaiI YATR 8 cut(s) 20, 35, 69, 71, 115, 117, 173, 229
FatI CATG 1 cut(s) 33
Fnu4HI GCNGC 2 cut(s) 39, 180
Fsp4HI GCNGC 2 cut(s) 39, 180
FspBI CTAG 1 cut(s) 80
GluI GCNGC 2 cut(s) 39, 180
GsuI CTGGAG 1 cut(s) 110
Hin1II CATG 1 cut(s) 37
HinfI GANTC 1 cut(s) 166
HphI GGTGA 1 cut(s) 154
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 50
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 204
Hsp92II CATG 1 cut(s) 37
LmnI GCTCC 1 cut(s) 187
LpnPI CCDG 8 cut(s) 11, 74, 89, 121, 189, 198, 203, 216
Lsp1109I GCAGC 2 cut(s) 50, 191
LweI GCATC 1 cut(s) 11
MaeI CTAG 1 cut(s) 80
MaeIII GTNAC 1 cut(s) 131
MnlI CCTC 4 cut(s) 69, 85, 138, 199
Mva1269I GAATGC 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 47
NlaIII CATG 1 cut(s) 37
NmuCI GTSAC 1 cut(s) 131
PctI GAATGC 1 cut(s) 50
PfeI GAWTC 1 cut(s) 166
PkrI GCNGC 2 cut(s) 40, 181
PstNI CAGNNNCTG 1 cut(s) 185
SatI GCNGC 2 cut(s) 39, 180
SetI ASST 4 cut(s) 140, 184, 195, 205
SfaNI GCATC 1 cut(s) 11
SsiI CCGC 1 cut(s) 148
SspMI CTAG 1 cut(s) 80
TfiI GAWTC 1 cut(s) 166
TscAI CASTG 1 cut(s) 136
TseFI GTSAC 1 cut(s) 131
TseI GCWGC 2 cut(s) 38, 179
Tsp45I GTSAC 1 cut(s) 131
TspDTI ATGAA 1 cut(s) 22
TspRI CASTG 1 cut(s) 136
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.