Rmu_ssc0000100.1_g000023

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000100.1
OG0031002
Physical Location & Seq
Reverse (-)
94297 .. 94782
486 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 486 bp
atgtttctgaggcaacataatgatcctagcctacgctgggagtaccttcagttgaagacacccaaagaaatgtgggatacccttaagggacgttttgggaacattcataacaccttgctctcagaactgaccattcagtggaatgaaatccgcttgcttgactacaaaagagtcaatgacttcaacaaggacatgttgtgcctaaaggcacatctaaatttatgtggaaaggaactcacagaagatgatatgatccagaagtctctttccacttttcccatttcagcacttatactaacgaaccagtataggctagggtatgacaacataagaatcacaacctttaataagctgatcaacctactgcaagtggctgagagggataatgatgttctcttgaacaacaatgccaggcccactgggacaaagaaaattcctgaggctaattatggaaaaatgaaaggtggaaagaaccctaatgcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

161

Amino Acids

18.77

Weight (kDa)

9.23

Isoelectric Point (pI)

39.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031002)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000441.1_g000013 Rmu_ssc0000100.1_g000023

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 138
AciI CCGC 1 cut(s) 151
AclWI GGATC 2 cut(s) 17, 247
AcsI RAATTY 2 cut(s) 217, 432
AcuI CTGAAG 1 cut(s) 32
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 2 cut(s) 37, 138
AflII CTTAAG 1 cut(s) 83
AflIII ACRYGT 1 cut(s) 192
AgsI TTSAA 3 cut(s) 55, 184, 400
AjnI CCWGG 1 cut(s) 410
AluBI AGCT 1 cut(s) 352
AluI AGCT 1 cut(s) 352
Alw26I GTCTC 1 cut(s) 267
AlwI GGATC 2 cut(s) 17, 247
AoxI GGCC 1 cut(s) 413
ApoI RAATTY 2 cut(s) 217, 432
AspS9I GGNCC 1 cut(s) 414
AxyI CCTNAGG 1 cut(s) 438
BbsI GAAGAC 1 cut(s) 62
BciT130I CCWGG 1 cut(s) 412
BciVI GTATCC 1 cut(s) 70
BclI TGATCA 1 cut(s) 354
BcoDI GTCTC 1 cut(s) 267
BfaI CTAG 2 cut(s) 27, 314
BfrI CTTAAG 1 cut(s) 83
BfuI GTATCC 1 cut(s) 70
Bme1390I CCNGG 1 cut(s) 412
BmgT120I GGNCC 1 cut(s) 414
BmrFI CCNGG 1 cut(s) 412
BmrI ACTGGG 1 cut(s) 429
BmuI ACTGGG 1 cut(s) 429
BpiI GAAGAC 1 cut(s) 62
Bsc4I CCNNNNNNNGG 2 cut(s) 37, 138
Bse1I ACTGG 2 cut(s) 304, 424
Bse21I CCTNAGG 1 cut(s) 438
BseBI CCWGG 1 cut(s) 412
BseLI CCNNNNNNNGG 2 cut(s) 37, 138
BseMII CTCAG 3 cut(s) 135, 366, 429
BseNI ACTGG 2 cut(s) 304, 424
BseYI CCCAGC 1 cut(s) 36
BshFI GGCC 1 cut(s) 415
BslFI GGGAC 2 cut(s) 102, 436
BslI CCNNNNNNNGG 2 cut(s) 37, 138
BsmAI GTCTC 1 cut(s) 267
BsmFI GGGAC 2 cut(s) 102, 436
BsnI GGCC 1 cut(s) 415
Bsp143I GATC 3 cut(s) 22, 252, 354
BspACI CCGC 1 cut(s) 151
BspANI GGCC 1 cut(s) 415
BspCNI CTCAG 3 cut(s) 134, 367, 430
BspPI GGATC 2 cut(s) 17, 247
BspTI CTTAAG 1 cut(s) 83
BsrI ACTGG 2 cut(s) 304, 424
BssMI GATC 3 cut(s) 22, 252, 354
Bst2UI CCWGG 1 cut(s) 412
BstAFI CTTAAG 1 cut(s) 83
BstC8I GCNNGC 1 cut(s) 155
BstDEI CTNAG 4 cut(s) 8, 121, 375, 438
BstKTI GATC 3 cut(s) 25, 255, 357
BstMAI GTCTC 1 cut(s) 267
BstMBI GATC 3 cut(s) 22, 252, 354
BstNI CCWGG 1 cut(s) 412
BstNSI RCATGY 1 cut(s) 196
BstSCI CCNGG 1 cut(s) 410
BstV2I GAAGAC 1 cut(s) 62
Bsu36I CCTNAGG 1 cut(s) 438
BsuI GTATCC 1 cut(s) 70
BsuRI GGCC 1 cut(s) 415
BtsIMutI CAGTG 2 cut(s) 143, 417
Cac8I GCNNGC 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 414
Csp6I GTAC 1 cut(s) 43
CviAII CATG 1 cut(s) 193
CviJI RGCY 6 cut(s) 30, 313, 352, 374, 415, 443
CviKI_1 RGCY 6 cut(s) 30, 313, 352, 374, 415, 443
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 4 cut(s) 8, 121, 375, 438
DpnI GATC 3 cut(s) 24, 254, 356
DpnII GATC 3 cut(s) 22, 252, 354
Eco57I CTGAAG 1 cut(s) 32
Eco81I CCTNAGG 1 cut(s) 438
EcoRII CCWGG 1 cut(s) 410
EcoT22I ATGCAT 1 cut(s) 484
FaeI CATG 1 cut(s) 196
FaqI GGGAC 2 cut(s) 102, 436
FatI CATG 1 cut(s) 192
FbaI TGATCA 1 cut(s) 354
FspBI CTAG 2 cut(s) 27, 314
GsaI CCCAGC 1 cut(s) 40
HaeIII GGCC 1 cut(s) 415
Hin1II CATG 1 cut(s) 196
HinfI GANTC 2 cut(s) 171, 333
Hpy188I TCNGA 2 cut(s) 9, 124
Hpy188III TCNNGA 3 cut(s) 256, 397, 437
HpyAV CCTTC 1 cut(s) 56
HpyCH4IV ACGT 1 cut(s) 91
HpyCH4V TGCA 2 cut(s) 367, 482
HpyF3I CTNAG 4 cut(s) 8, 121, 375, 438
HpySE526I ACGT 1 cut(s) 91
Hsp92II CATG 1 cut(s) 196
Ksp22I TGATCA 1 cut(s) 354
Kzo9I GATC 3 cut(s) 22, 252, 354
LpnPI CCDG 7 cut(s) 22, 269, 317, 397, 405, 424, 450
MaeI CTAG 2 cut(s) 27, 314
MaeII ACGT 1 cut(s) 91
MalI GATC 3 cut(s) 24, 254, 356
MboI GATC 3 cut(s) 22, 252, 354
MboII GAAGA 2 cut(s) 67, 254
MluCI AATT 3 cut(s) 217, 432, 445
MlyI GAGTC 1 cut(s) 180
MnlI CCTC 3 cut(s) 3, 372, 433
Mph1103I ATGCAT 1 cut(s) 484
MseI TTAA 2 cut(s) 84, 345
MspCI CTTAAG 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 412
MvaI CCWGG 1 cut(s) 412
NdeII GATC 3 cut(s) 22, 252, 354
NlaIII CATG 1 cut(s) 196
NsiI ATGCAT 1 cut(s) 484
NspI RCATGY 1 cut(s) 196
PciI ACATGT 1 cut(s) 192
PfeI GAWTC 1 cut(s) 333
PflMI CCANNNNNTGG 1 cut(s) 138
PleI GAGTC 1 cut(s) 179
PpsI GAGTC 1 cut(s) 179
PscI ACATGT 1 cut(s) 192
Psp6I CCWGG 1 cut(s) 410
PspFI CCCAGC 1 cut(s) 36
PspGI CCWGG 1 cut(s) 410
PspPI GGNCC 1 cut(s) 414
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 84, 345
Sau3AI GATC 3 cut(s) 22, 252, 354
Sau96I GGNCC 1 cut(s) 414
SchI GAGTC 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 412
SetI ASST 7 cut(s) 48, 94, 116, 344, 354, 363, 466
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 3 cut(s) 217, 432, 445
SsiI CCGC 1 cut(s) 151
SspMI CTAG 2 cut(s) 27, 314
StyD4I CCNGG 1 cut(s) 410
TaiI ACGT 1 cut(s) 94
TasI AATT 3 cut(s) 217, 432, 445
TfiI GAWTC 1 cut(s) 333
Tru1I TTAA 2 cut(s) 84, 345
Tru9I TTAA 2 cut(s) 84, 345
TscAI CASTG 2 cut(s) 143, 424
TspDTI ATGAA 3 cut(s) 95, 159, 473
TspRI CASTG 2 cut(s) 143, 424
Van91I CCANNNNNTGG 1 cut(s) 138
Vha464I CTTAAG 1 cut(s) 83
XapI RAATTY 2 cut(s) 217, 432
XceI RCATGY 1 cut(s) 196
XspI CTAG 2 cut(s) 27, 314
Zsp2I ATGCAT 1 cut(s) 484
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.