Rmu_ssc0000135.1_g000039

Plant protein 1589 of unknown function (A_thal_3526)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000135.1
OG0031008
Physical Location & Seq
Forward (+)
204487 .. 204847
361 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
atgaagacgttacagagtgggcaagaaatacaatcttcaaaccaagctatacatgatacacaaggtgaccaagtgaaaaaccaaacaaatgaggctcctggaactgattcagcttcaatatcatcttcgggcaatgacaacaagaaagtatcacgccaagatattgaacttgtaaggccaccaaatcaaactattcttgcaaccttttctttttctttttctacatttgttattctattatgttttaccgtgttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
A_thal_3526

Protein Analysis

85

Amino Acids

9.3

Weight (kDa)

5.04

Isoelectric Point (pI)

56.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031008)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8298525.1_g000001 Rmu_ssc0000135.1_g000039

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 65
AgsI TTSAA 3 cut(s) 39, 117, 167
AjnI CCWGG 1 cut(s) 97
AluBI AGCT 2 cut(s) 47, 113
AluI AGCT 2 cut(s) 47, 113
AoxI GGCC 1 cut(s) 176
Asp700I GAANNNNTTC 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 11
BciT130I CCWGG 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 99
BmiI GGNNCC 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 99
BpiI GAAGAC 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 139
BseBI CCWGG 1 cut(s) 99
BseMI GCAATG 1 cut(s) 139
BshFI GGCC 1 cut(s) 178
BsnI GGCC 1 cut(s) 178
BspANI GGCC 1 cut(s) 178
BspLI GGNNCC 1 cut(s) 96
BsrDI GCAATG 1 cut(s) 139
Bst2UI CCWGG 1 cut(s) 99
Bst4CI ACNGT 1 cut(s) 250
BstEII GGTNACC 1 cut(s) 65
BstNI CCWGG 1 cut(s) 99
BstPI GGTNACC 1 cut(s) 65
BstSCI CCNGG 1 cut(s) 97
BstV2I GAAGAC 1 cut(s) 11
BsuRI GGCC 1 cut(s) 178
CviAII CATG 1 cut(s) 53
CviJI RGCY 4 cut(s) 47, 95, 113, 178
CviKI_1 RGCY 4 cut(s) 47, 95, 113, 178
DraIII CACNNNGTG 1 cut(s) 65
Eco91I GGTNACC 1 cut(s) 65
EcoO65I GGTNACC 1 cut(s) 65
EcoRII CCWGG 1 cut(s) 97
FaeI CATG 1 cut(s) 56
FaiI YATR 3 cut(s) 50, 54, 241
FatI CATG 1 cut(s) 52
HaeIII GGCC 1 cut(s) 178
Hin1II CATG 1 cut(s) 56
HinfI GANTC 1 cut(s) 107
HphI GGTGA 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 257
HpyCH4III ACNGT 1 cut(s) 250
HpyCH4IV ACGT 1 cut(s) 8
HpyCH4V TGCA 1 cut(s) 200
HpySE526I ACGT 1 cut(s) 8
Hsp92II CATG 1 cut(s) 56
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 2 cut(s) 84, 111
MaeII ACGT 1 cut(s) 8
MaeIII GTNAC 2 cut(s) 9, 65
MboII GAAGA 3 cut(s) 16, 27, 117
MnlI CCTC 1 cut(s) 85
MroXI GAANNNNTTC 1 cut(s) 106
MspR9I CCNGG 1 cut(s) 99
MvaI CCWGG 1 cut(s) 99
NlaIII CATG 1 cut(s) 56
NlaIV GGNNCC 1 cut(s) 96
NmuCI GTSAC 1 cut(s) 65
PdmI GAANNNNTTC 1 cut(s) 106
PfeI GAWTC 1 cut(s) 107
PfoI TCCNGGA 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 97
PspEI GGTNACC 1 cut(s) 65
PspGI CCWGG 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 96
ScrFI CCNGG 1 cut(s) 99
SetI ASST 5 cut(s) 11, 49, 67, 115, 206
StyD4I CCNGG 1 cut(s) 97
TaaI ACNGT 1 cut(s) 250
TaiI ACGT 1 cut(s) 11
TfiI GAWTC 1 cut(s) 107
TseFI GTSAC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 17
XmnI GAANNNNTTC 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.