Rmu_ssc0000472.1_g000005

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000472.1
OG0031024
Physical Location & Seq
Reverse (-)
24636 .. 25782
1147 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 408 bp
atggtggatgttccagagttcaaggccccccatttcggagacgaatcggagcaactccgaaagaagtgcgctacggtttccgagttcgattccaacaagaggcctcctcatagagctggactcaaagttgctactgcattgcccattgcttctgagcaatctcaatttgcctccaaacaaaacagcaaggtgtaccctcgccggcgccctcgttgtactccgggaaatactggtccacaatctcgtgatactccgccgaatatagatactggtattgctagtgagaaggaatggggtattagcttgttaaacgaacatgtgaaggaatccgacactaaagaagatggaagtacttggtaccgagaaagcggggagaagctgaggaacactgagtacagatttaggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

135

Amino Acids

15.32

Weight (kDa)

8.93

Isoelectric Point (pI)

52.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031024)

Species Orthologous Gene IDs
rosa_multiflora Rmu_ssc0000472.1_g000005
rosa_samantha Rh5DG440500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 357
AccB1I GGYRCC 2 cut(s) 204, 357
AciI CCGC 2 cut(s) 254, 369
AcyI GRCGYC 1 cut(s) 205
AfaI GTAC 5 cut(s) 194, 217, 352, 359, 395
AfiI CCNNNNNNNGG 2 cut(s) 35, 99
AflIII ACRYGT 1 cut(s) 316
AgsI TTSAA 1 cut(s) 22
AluBI AGCT 3 cut(s) 116, 303, 379
AluI AGCT 3 cut(s) 116, 303, 379
Alw26I GTCTC 1 cut(s) 33
AoxI GGCC 2 cut(s) 24, 101
Asp718I GGTACC 1 cut(s) 357
AspLEI GCGC 2 cut(s) 71, 207
AspS9I GGNCC 2 cut(s) 25, 233
AsuC2I CCSGG 1 cut(s) 222
AvaII GGWCC 1 cut(s) 233
BanI GGYRCC 2 cut(s) 204, 357
BauI CACGAG 1 cut(s) 243
BbvCI CCTCAGC 1 cut(s) 380
BccI CCATC 1 cut(s) 338
BcgI CGANNNNNNTGC 2 cut(s) 48, 82
BcnI CCSGG 1 cut(s) 222
BcoDI GTCTC 1 cut(s) 33
BfaI CTAG 1 cut(s) 279
BfoI RGCGCY 1 cut(s) 208
BmcAI AGTACT 1 cut(s) 352
Bme1390I CCNGG 1 cut(s) 222
Bme18I GGWCC 1 cut(s) 233
BmgT120I GGNCC 2 cut(s) 25, 233
BmiI GGNNCC 3 cut(s) 27, 206, 359
BmrFI CCNGG 1 cut(s) 222
BplI GAGNNNNNCTC 4 cut(s) 91, 123, 105, 137
Bpu10I CCTNAGC 1 cut(s) 380
BpuMI CCSGG 1 cut(s) 222
BsaHI GRCGYC 1 cut(s) 205
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 99
Bse118I RCCGGY 1 cut(s) 201
Bse1I ACTGG 2 cut(s) 235, 274
Bse3DI GCAATG 2 cut(s) 137, 144
BseGI GGATG 1 cut(s) 13
BseLI CCNNNNNNNGG 2 cut(s) 35, 99
BseMI GCAATG 2 cut(s) 137, 144
BseMII CTCAG 3 cut(s) 144, 371, 381
BseNI ACTGG 2 cut(s) 235, 274
BseRI GAGGAG 1 cut(s) 96
BshFI GGCC 2 cut(s) 26, 103
BshNI GGYRCC 2 cut(s) 204, 357
BsiSI CCGG 2 cut(s) 202, 221
BslI CCNNNNNNNGG 2 cut(s) 35, 99
BsmAI GTCTC 1 cut(s) 33
BsmBI CGTCTC 1 cut(s) 33
BsnI GGCC 2 cut(s) 26, 103
BspACI CCGC 2 cut(s) 254, 369
BspANI GGCC 2 cut(s) 26, 103
BspCNI CTCAG 3 cut(s) 145, 372, 382
BspLI GGNNCC 3 cut(s) 27, 206, 359
BspT107I GGYRCC 2 cut(s) 204, 357
BsrDI GCAATG 2 cut(s) 137, 144
BsrFI RCCGGY 1 cut(s) 201
BsrI ACTGG 2 cut(s) 235, 274
BssAI RCCGGY 1 cut(s) 201
BssNI GRCGYC 1 cut(s) 205
BssSI CACGAG 1 cut(s) 243
Bst2BI CACGAG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 76
BstACI GRCGYC 1 cut(s) 205
BstC8I GCNNGC 1 cut(s) 203
BstDEI CTNAG 3 cut(s) 153, 380, 390
BstF5I GGATG 1 cut(s) 13
BstH2I RGCGCY 1 cut(s) 208
BstHHI GCGC 2 cut(s) 71, 207
BstMAI GTCTC 1 cut(s) 33
BstNSI RCATGY 1 cut(s) 320
BstSCI CCNGG 1 cut(s) 220
BsuRI GGCC 2 cut(s) 26, 103
BtsCI GGATG 1 cut(s) 13
BtsIMutI CAGTG 1 cut(s) 387
Cac8I GCNNGC 1 cut(s) 203
CfoI GCGC 2 cut(s) 71, 207
Cfr10I RCCGGY 1 cut(s) 201
Cfr13I GGNCC 2 cut(s) 25, 233
Csp6I GTAC 5 cut(s) 193, 216, 351, 358, 394
CviAII CATG 1 cut(s) 317
CviJI RGCY 5 cut(s) 26, 103, 116, 303, 379
CviKI_1 RGCY 5 cut(s) 26, 103, 116, 303, 379
CviQI GTAC 5 cut(s) 193, 216, 351, 358, 394
DdeI CTNAG 3 cut(s) 153, 380, 390
DinI GGCGCC 1 cut(s) 206
EciI GGCGGA 1 cut(s) 243
Eco147I AGGCCT 1 cut(s) 103
Eco47I GGWCC 1 cut(s) 233
EcoO109I RGGNCCY 1 cut(s) 25
EgeI GGCGCC 1 cut(s) 206
EheI GGCGCC 1 cut(s) 206
Esp3I CGTCTC 1 cut(s) 33
FaeI CATG 1 cut(s) 320
FaiI YATR 3 cut(s) 111, 263, 318
FatI CATG 1 cut(s) 316
FauI CCCGC 1 cut(s) 362
FokI GGATG 1 cut(s) 20
FspBI CTAG 1 cut(s) 279
GlaI GCGC 2 cut(s) 70, 206
HaeII RGCGCY 1 cut(s) 208
HaeIII GGCC 2 cut(s) 26, 103
HapII CCGG 2 cut(s) 202, 221
HhaI GCGC 2 cut(s) 71, 207
Hin1I GRCGYC 1 cut(s) 205
Hin1II CATG 1 cut(s) 320
Hin6I GCGC 2 cut(s) 69, 205
HinP1I GCGC 2 cut(s) 69, 205
HinfI GANTC 4 cut(s) 44, 89, 120, 326
HpaII CCGG 2 cut(s) 202, 221
Hpy166II GTNNAC 2 cut(s) 193, 236
Hpy188I TCNGA 6 cut(s) 38, 49, 59, 82, 154, 331
Hpy188III TCNNGA 2 cut(s) 14, 245
Hpy8I GTNNAC 2 cut(s) 193, 236
HpyAV CCTTC 2 cut(s) 280, 316
HpyCH4III ACNGT 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 137
HpyF3I CTNAG 3 cut(s) 153, 380, 390
Hsp92I GRCGYC 1 cut(s) 205
Hsp92II CATG 1 cut(s) 320
HspAI GCGC 2 cut(s) 69, 205
KasI GGCGCC 1 cut(s) 204
KpnI GGTACC 1 cut(s) 361
KroI GCCGGC 1 cut(s) 201
KroNI GCCGGC 1 cut(s) 203
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 6 cut(s) 27, 102, 215, 216, 234, 255
MaeI CTAG 1 cut(s) 279
MboII GAAGA 1 cut(s) 353
MluCI AATT 1 cut(s) 164
Mly113I GGCGCC 1 cut(s) 205
MlyI GAGTC 1 cut(s) 114
MmeI TCCRAC 2 cut(s) 117, 354
MnlI CCTC 7 cut(s) 93, 114, 117, 181, 207, 219, 375
MreI CGCCGGCG 1 cut(s) 201
MroNI GCCGGC 1 cut(s) 201
MseI TTAA 1 cut(s) 308
MspI CCGG 2 cut(s) 202, 221
MspR9I CCNGG 1 cut(s) 222
NaeI GCCGGC 1 cut(s) 203
NarI GGCGCC 1 cut(s) 205
NciI CCSGG 1 cut(s) 222
NgoMIV GCCGGC 1 cut(s) 201
NlaIII CATG 1 cut(s) 320
NlaIV GGNNCC 3 cut(s) 27, 206, 359
NspI RCATGY 1 cut(s) 320
PceI AGGCCT 1 cut(s) 103
PciI ACATGT 1 cut(s) 316
PdiI GCCGGC 1 cut(s) 203
PfeI GAWTC 3 cut(s) 44, 89, 326
PfoI TCCNGGA 1 cut(s) 220
PleI GAGTC 1 cut(s) 114
PluTI GGCGCC 1 cut(s) 208
PpsI GAGTC 1 cut(s) 114
PscI ACATGT 1 cut(s) 316
PspN4I GGNNCC 3 cut(s) 27, 206, 359
PspPI GGNCC 2 cut(s) 25, 233
PsrI GAACNNNNNNTAC 1 cut(s) 377
RsaI GTAC 5 cut(s) 194, 217, 352, 359, 395
RsaNI GTAC 5 cut(s) 193, 216, 351, 358, 394
SaqAI TTAA 1 cut(s) 308
Sau96I GGNCC 2 cut(s) 25, 233
ScaI AGTACT 1 cut(s) 352
SchI GAGTC 1 cut(s) 114
ScrFI CCNGG 1 cut(s) 222
SetI ASST 5 cut(s) 118, 192, 305, 381, 407
SfoI GGCGCC 1 cut(s) 206
SgrAI CRCCGGYG 1 cut(s) 201
SinI GGWCC 1 cut(s) 233
Sse9I AATT 1 cut(s) 164
SseBI AGGCCT 1 cut(s) 103
SsiI CCGC 2 cut(s) 254, 369
SspDI GGCGCC 1 cut(s) 204
SspMI CTAG 1 cut(s) 279
StuI AGGCCT 1 cut(s) 103
StyD4I CCNGG 1 cut(s) 220
TaaI ACNGT 1 cut(s) 76
TaqI TCGA 1 cut(s) 87
TasI AATT 1 cut(s) 164
TatI WGTACW 3 cut(s) 215, 350, 393
TfiI GAWTC 3 cut(s) 44, 89, 326
Tru1I TTAA 1 cut(s) 308
Tru9I TTAA 1 cut(s) 308
TscAI CASTG 1 cut(s) 394
TspRI CASTG 1 cut(s) 394
VpaK11BI GGWCC 1 cut(s) 233
XceI RCATGY 1 cut(s) 320
XspI CTAG 1 cut(s) 279
ZrmI AGTACT 1 cut(s) 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.