Rroxscaffold_1G00006400

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
8489987 .. 8490232
246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00006400.1

Sequence Viewer

Length: 246 bp
ATGTGCCTCGCTAGGATATGCATGTGTGCTATCTGCATTGTAGGTCTGATAATCACAATCGGTTTTTTGCTTGGTTATGGTCCATTCAAAAAGTGGCATGGTCATCATACAAAACGGACCCAGCTCTTCGTAGATATTAACTGTAATCCATATGCTCCTGGATCTCTATGTAGACCTGGAAGACCATTACTAGCACCTGCACCTTCACCTTCGTGGTTCGATCACCTAGCACCTTCACCCTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.94

Weight (kDa)

9.12

Isoelectric Point (pI)

55.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030196)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0075201
rosa_roxburghii Rroxscaffold_1G00006400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 205
Acc36I ACCTGC 1 cut(s) 205
AccI GTMKAC 1 cut(s) 172
AclWI GGATC 1 cut(s) 169
AgsI TTSAA 1 cut(s) 88
AjnI CCWGG 2 cut(s) 157, 175
AleI CACNNNNGTG 1 cut(s) 211
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
AlwI GGATC 1 cut(s) 169
AspS9I GGNCC 2 cut(s) 80, 117
AsuHPI GGTGA 3 cut(s) 198, 215, 228
AvaII GGWCC 2 cut(s) 80, 117
BbsI GAAGAC 1 cut(s) 187
BciT130I CCWGG 2 cut(s) 159, 177
BfaI CTAG 4 cut(s) 12, 191, 227, 244
BfuAI ACCTGC 1 cut(s) 205
Bme1390I CCNGG 2 cut(s) 159, 177
Bme18I GGWCC 2 cut(s) 80, 117
BmgT120I GGNCC 2 cut(s) 80, 117
BmiI GGNNCC 1 cut(s) 119
BmrFI CCNGG 2 cut(s) 159, 177
BpiI GAAGAC 1 cut(s) 187
BseBI CCWGG 2 cut(s) 159, 177
BseYI CCCAGC 1 cut(s) 120
BsgI GTGCAG 1 cut(s) 183
Bsp143I GATC 2 cut(s) 161, 220
BspLI GGNNCC 1 cut(s) 119
BspMI ACCTGC 1 cut(s) 205
BspPI GGATC 1 cut(s) 169
BspQI GCTCTTC 1 cut(s) 131
BssMI GATC 2 cut(s) 161, 220
Bst2UI CCWGG 2 cut(s) 159, 177
Bst4CI ACNGT 1 cut(s) 143
Bst6I CTCTTC 1 cut(s) 131
BstKTI GATC 2 cut(s) 164, 223
BstMBI GATC 2 cut(s) 161, 220
BstNI CCWGG 2 cut(s) 159, 177
BstNSI RCATGY 1 cut(s) 25
BstSCI CCNGG 2 cut(s) 157, 175
BstV2I GAAGAC 1 cut(s) 187
BstX2I RGATCY 1 cut(s) 161
BstYI RGATCY 1 cut(s) 161
BveI ACCTGC 1 cut(s) 205
Cfr13I GGNCC 2 cut(s) 80, 117
CviAII CATG 2 cut(s) 22, 98
CviJI RGCY 1 cut(s) 124
CviKI_1 RGCY 1 cut(s) 124
DpnI GATC 2 cut(s) 163, 222
DpnII GATC 2 cut(s) 161, 220
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco47I GGWCC 2 cut(s) 80, 117
EcoRII CCWGG 2 cut(s) 157, 175
EcoT22I ATGCAT 1 cut(s) 23
FaeI CATG 2 cut(s) 25, 101
FaiI YATR 8 cut(s) 19, 23, 78, 99, 108, 151, 153, 169
FatI CATG 2 cut(s) 21, 97
FauNDI CATATG 1 cut(s) 151
FblI GTMKAC 1 cut(s) 172
FspBI CTAG 4 cut(s) 12, 191, 227, 244
GsaI CCCAGC 1 cut(s) 124
Hin1II CATG 2 cut(s) 25, 101
HphI GGTGA 3 cut(s) 198, 215, 228
Hpy166II GTNNAC 1 cut(s) 173
Hpy188I TCNGA 1 cut(s) 48
Hpy8I GTNNAC 1 cut(s) 173
HpyAV CCTTC 3 cut(s) 213, 219, 243
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4V TGCA 3 cut(s) 21, 36, 200
Hsp92II CATG 2 cut(s) 25, 101
Kzo9I GATC 2 cut(s) 161, 220
LguI GCTCTTC 1 cut(s) 131
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 6 cut(s) 134, 144, 162, 171, 189, 210
MaeI CTAG 4 cut(s) 12, 191, 227, 244
MalI GATC 2 cut(s) 163, 222
MboI GATC 2 cut(s) 161, 220
MboII GAAGA 2 cut(s) 118, 192
MflI RGATCY 1 cut(s) 161
MnlI CCTC 1 cut(s) 17
Mph1103I ATGCAT 1 cut(s) 23
MseI TTAA 1 cut(s) 138
MslI CAYNNNNRTG 1 cut(s) 211
MspR9I CCNGG 2 cut(s) 159, 177
MvaI CCWGG 2 cut(s) 159, 177
NdeI CATATG 1 cut(s) 151
NdeII GATC 2 cut(s) 161, 220
NlaIII CATG 2 cut(s) 25, 101
NlaIV GGNNCC 1 cut(s) 119
NsiI ATGCAT 1 cut(s) 23
NspI RCATGY 1 cut(s) 25
OliI CACNNNNGTG 1 cut(s) 211
PaqCI CACCTGC 1 cut(s) 205
PciSI GCTCTTC 1 cut(s) 131
PfoI TCCNGGA 1 cut(s) 157
Psp6I CCWGG 2 cut(s) 157, 175
PspFI CCCAGC 1 cut(s) 120
PspGI CCWGG 2 cut(s) 157, 175
PspN4I GGNNCC 1 cut(s) 119
PspPI GGNCC 2 cut(s) 80, 117
PsuI RGATCY 1 cut(s) 161
RseI CAYNNNNRTG 1 cut(s) 211
SapI GCTCTTC 1 cut(s) 131
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 2 cut(s) 161, 220
Sau96I GGNCC 2 cut(s) 80, 117
ScrFI CCNGG 2 cut(s) 159, 177
SetI ASST 8 cut(s) 46, 126, 178, 199, 205, 211, 228, 235
SinI GGWCC 2 cut(s) 80, 117
SmiMI CAYNNNNRTG 1 cut(s) 211
SspMI CTAG 4 cut(s) 12, 191, 227, 244
StyD4I CCNGG 2 cut(s) 157, 175
TaaI ACNGT 1 cut(s) 143
TaqI TCGA 1 cut(s) 219
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TspGWI ACGGA 1 cut(s) 130
VpaK11BI GGWCC 2 cut(s) 80, 117
XceI RCATGY 1 cut(s) 25
XcmI CCANNNNNNNNNTGG 1 cut(s) 90
XmiI GTMKAC 1 cut(s) 172
XspI CTAG 4 cut(s) 12, 191, 227, 244
Zsp2I ATGCAT 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.