Rroxscaffold_2G00134290

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
71762334 .. 71764585
2252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00134290.1

Sequence Viewer

Length: 171 bp
ATGAATAATTATTATGGTTGCTTCTATTTTGATGTGGGTGTGTGCAGTCTTATATTCAACTATGATCCAATAATTGAGAATCTCTGTGACTTGGACTGTGATATCTGGCAACCCTACCAAATAACGAAGGGAAAATGCTACCAAATTGGAAGAAGCCCCATTCTTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.57

Weight (kDa)

4.17

Isoelectric Point (pI)

55.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022829)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0237151
rosa_roxburghii Rroxscaffold_1G00066070 Rroxscaffold_2G00134290
rosa_samantha Rh2DG476300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AgsI TTSAA 1 cut(s) 58
AlwI GGATC 1 cut(s) 59
BsgI GTGCAG 1 cut(s) 64
Bsp143I GATC 1 cut(s) 64
BspPI GGATC 1 cut(s) 59
BssMI GATC 1 cut(s) 64
Bst4CI ACNGT 1 cut(s) 98
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
CviJI RGCY 1 cut(s) 156
CviKI_1 RGCY 1 cut(s) 156
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
Eco32I GATATC 1 cut(s) 103
EcoRV GATATC 1 cut(s) 103
FaiI YATR 3 cut(s) 15, 53, 63
HinfI GANTC 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4V TGCA 1 cut(s) 45
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 1 cut(s) 91
MaeIII GTNAC 1 cut(s) 86
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 1 cut(s) 162
MluCI AATT 3 cut(s) 7, 72, 144
NdeII GATC 1 cut(s) 64
NmuCI GTSAC 1 cut(s) 86
PfeI GAWTC 1 cut(s) 79
Sau3AI GATC 1 cut(s) 64
SgeI CNNG 2 cut(s) 103, 118
Sse9I AATT 3 cut(s) 7, 72, 144
TaaI ACNGT 1 cut(s) 98
TasI AATT 3 cut(s) 7, 72, 144
TfiI GAWTC 1 cut(s) 79
TseFI GTSAC 1 cut(s) 86
Tsp45I GTSAC 1 cut(s) 86
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.