Rroxscaffold_2G00151080

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
88380373 .. 88380853
481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00151080.1

Sequence Viewer

Length: 375 bp
ATGAATGAGATTACACTTATAGCTGAGCTTCAACATAGTAATCTTGTTCAGCTTTTGGGTTCTTGCATTCAAGGAGAAGAGAAGATACTGATCTACGAATTTATGACAAATAGAAGCTTGGATGCCTTCCTATTTGAATTCACTACAGAGAACCATTTAGATTGGCAAATACGCGTCAGCATCATTGCAGGGATTGCACAAGAACTTCTCTATCTTCATAAGCATTCGAGAGTTAGAGTCATACACAAAGATCTTAAAGCTAGTAACATTCTACTGGATGAAAATATGAATCCTAAGATCTCAGACTTTGGCATGGCCAGACTTTTTGCACCTGATGAATCTGGAGCAAAACCAAATAGAGTTGTTGGAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

124

Amino Acids

14.14

Weight (kDa)

5.68

Isoelectric Point (pI)

33.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 1 - 113 3.5e-24 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 1 - 124 4.5e-23 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031963)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_2G00151080
rosa_wichuraiana Rw2G004300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 174
AcoI YGGCCR 1 cut(s) 315
AcsI RAATTY 2 cut(s) 98, 137
AflIII ACRYGT 1 cut(s) 172
AgsI TTSAA 3 cut(s) 32, 71, 137
AluBI AGCT 5 cut(s) 23, 28, 52, 117, 260
AluI AGCT 5 cut(s) 23, 28, 52, 117, 260
AoxI GGCC 1 cut(s) 315
ApoI RAATTY 2 cut(s) 98, 137
BalI TGGCCA 1 cut(s) 317
BarI GAAGNNNNNNTAC 2 cut(s) 69, 101
BfaI CTAG 1 cut(s) 261
BfmI CTRYAG 1 cut(s) 144
BglII AGATCT 2 cut(s) 250, 297
BlpI GCTNAGC 1 cut(s) 24
BmsI GCATC 2 cut(s) 112, 189
BpmI CTGGAG 1 cut(s) 363
Bpu1102I GCTNAGC 1 cut(s) 24
BsaBI GATNNNNATC 1 cut(s) 89
Bse1I ACTGG 1 cut(s) 279
Bse3DI GCAATG 1 cut(s) 183
Bse8I GATNNNNATC 1 cut(s) 89
BseGI GGATG 2 cut(s) 127, 283
BseJI GATNNNNATC 1 cut(s) 89
BseMI GCAATG 1 cut(s) 183
BseMII CTCAG 2 cut(s) 15, 315
BseNI ACTGG 1 cut(s) 279
Bsh1236I CGCG 1 cut(s) 174
BshFI GGCC 1 cut(s) 317
BsmI GAATGC 2 cut(s) 66, 223
BsnI GGCC 1 cut(s) 317
Bsp143I GATC 3 cut(s) 90, 250, 297
Bsp1720I GCTNAGC 1 cut(s) 24
BspANI GGCC 1 cut(s) 317
BspCNI CTCAG 2 cut(s) 16, 314
BspFNI CGCG 1 cut(s) 174
BsrDI GCAATG 1 cut(s) 183
BsrI ACTGG 1 cut(s) 279
BssMI GATC 3 cut(s) 90, 250, 297
Bst6I CTCTTC 1 cut(s) 72
BstAPI GCANNNNNTGC 1 cut(s) 194
BstDEI CTNAG 3 cut(s) 24, 294, 301
BstF5I GGATG 2 cut(s) 127, 283
BstFNI CGCG 1 cut(s) 174
BstKTI GATC 3 cut(s) 93, 253, 300
BstMBI GATC 3 cut(s) 90, 250, 297
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstSFI CTRYAG 1 cut(s) 144
BstUI CGCG 1 cut(s) 174
BstX2I RGATCY 2 cut(s) 250, 297
BstYI RGATCY 2 cut(s) 250, 297
BsuRI GGCC 1 cut(s) 317
BtsCI GGATG 2 cut(s) 127, 283
CseI GACGC 1 cut(s) 163
CviAII CATG 1 cut(s) 313
CviJI RGCY 6 cut(s) 23, 28, 52, 117, 260, 317
CviKI_1 RGCY 6 cut(s) 23, 28, 52, 117, 260, 317
DdeI CTNAG 3 cut(s) 24, 294, 301
DpnI GATC 3 cut(s) 92, 252, 299
DpnII GATC 3 cut(s) 90, 250, 297
EaeI YGGCCR 1 cut(s) 315
Eam1104I CTCTTC 1 cut(s) 72
EarI CTCTTC 1 cut(s) 72
EcoRI GAATTC 1 cut(s) 137
FaeI CATG 1 cut(s) 316
FaiI YATR 8 cut(s) 20, 36, 104, 219, 242, 287, 314, 373
FatI CATG 1 cut(s) 312
FokI GGATG 2 cut(s) 134, 290
FspBI CTAG 1 cut(s) 261
GsuI CTGGAG 1 cut(s) 363
HaeIII GGCC 1 cut(s) 317
HgaI GACGC 1 cut(s) 163
Hin1II CATG 1 cut(s) 316
HindIII AAGCTT 1 cut(s) 115
HinfI GANTC 3 cut(s) 237, 289, 338
Hpy188I TCNGA 1 cut(s) 304
Hpy188III TCNNGA 2 cut(s) 228, 342
HpyAV CCTTC 1 cut(s) 136
HpyCH4V TGCA 4 cut(s) 66, 188, 197, 329
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 3 cut(s) 24, 294, 301
Hsp92II CATG 1 cut(s) 316
Kzo9I GATC 3 cut(s) 90, 250, 297
LmnI GCTCC 1 cut(s) 344
LpnPI CCDG 5 cut(s) 174, 260, 327, 331, 345
LweI GCATC 2 cut(s) 112, 189
MaeI CTAG 1 cut(s) 261
MaeIII GTNAC 1 cut(s) 263
MalI GATC 3 cut(s) 92, 252, 299
MboI GATC 3 cut(s) 90, 250, 297
MboII GAAGA 3 cut(s) 89, 94, 206
MflI RGATCY 2 cut(s) 250, 297
MlsI TGGCCA 1 cut(s) 317
MluCI AATT 2 cut(s) 98, 137
MluI ACGCGT 1 cut(s) 172
MluNI TGGCCA 1 cut(s) 317
MlyI GAGTC 1 cut(s) 246
MmeI TCCRAC 1 cut(s) 346
Mox20I TGGCCA 1 cut(s) 317
MscI TGGCCA 1 cut(s) 317
MseI TTAA 1 cut(s) 255
Msp20I TGGCCA 1 cut(s) 317
Mva1269I GAATGC 2 cut(s) 66, 223
MvnI CGCG 1 cut(s) 174
MwoI GCNNNNNNNGC 1 cut(s) 194
NdeII GATC 3 cut(s) 90, 250, 297
NlaIII CATG 1 cut(s) 316
PctI GAATGC 2 cut(s) 66, 223
PfeI GAWTC 2 cut(s) 289, 338
PleI GAGTC 1 cut(s) 245
PpsI GAGTC 1 cut(s) 245
PsuI RGATCY 2 cut(s) 250, 297
SaqAI TTAA 1 cut(s) 255
Sau3AI GATC 3 cut(s) 90, 250, 297
SchI GAGTC 1 cut(s) 246
SetI ASST 6 cut(s) 25, 30, 54, 119, 262, 334
SfaNI GCATC 2 cut(s) 112, 189
SfcI CTRYAG 1 cut(s) 144
Sse9I AATT 2 cut(s) 98, 137
SspMI CTAG 1 cut(s) 261
TaqI TCGA 1 cut(s) 227
TasI AATT 2 cut(s) 98, 137
TfiI GAWTC 2 cut(s) 289, 338
Tru1I TTAA 1 cut(s) 255
Tru9I TTAA 1 cut(s) 255
TspDTI ATGAA 5 cut(s) 17, 206, 294, 302, 351
XapI RAATTY 2 cut(s) 98, 137
XspI CTAG 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.