Rroxscaffold_4G00299850

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
19775547 .. 19776242
696 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00299850.1

Sequence Viewer

Length: 264 bp
ATGCAGAGCCGATTTGCTGAGGTAATACTGAAAAGACTTGCACAAGTTACACTACCACATGGAAGAATATTTGGAGATGGATCTCGGTTATTCCAGCCGCAAGATAGAAGTACTGAAGCAGTTTCAAGAGAAACCAGAACATCAAGGGCTGAAGCTGCAGCAGTTGGGGGTACATGCAATACACAGAAAGAGAGAGACGAAGCTGCTACAATTCCCAGGATTCAGATTCTTCAGCTTTCCGACTTCAGTAACAAGCTGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.7

Weight (kDa)

10.0

Isoelectric Point (pI)

42.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024746)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0356021
rosa_roxburghii Rroxscaffold_4G00299850
rosa_samantha Rh1DG028500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 98
AclWI GGATC 1 cut(s) 88
AcuI CTGAAG 4 cut(s) 135, 171, 215, 229
AfaI GTAC 2 cut(s) 112, 172
AgsI TTSAA 1 cut(s) 126
AjnI CCWGG 1 cut(s) 215
AluBI AGCT 4 cut(s) 155, 203, 235, 256
AluI AGCT 4 cut(s) 155, 203, 235, 256
Alw26I GTCTC 1 cut(s) 189
AlwI GGATC 1 cut(s) 88
ApeKI GCWGC 3 cut(s) 155, 158, 203
BbvCI CCTCAGC 1 cut(s) 18
BbvI GCAGC 3 cut(s) 142, 170, 190
BccI CCATC 1 cut(s) 71
BciT130I CCWGG 1 cut(s) 217
BcoDI GTCTC 1 cut(s) 189
BfmI CTRYAG 1 cut(s) 156
BisI GCNGC 4 cut(s) 98, 156, 159, 204
BlsI GCNGC 4 cut(s) 99, 157, 160, 205
BmcAI AGTACT 1 cut(s) 112
Bme1390I CCNGG 1 cut(s) 217
BmrFI CCNGG 1 cut(s) 217
Bpu10I CCTNAGC 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 215
BseBI CCWGG 1 cut(s) 217
BseDI CCNNGG 1 cut(s) 215
BseMII CTCAG 1 cut(s) 9
BseXI GCAGC 3 cut(s) 142, 170, 190
BsmAI GTCTC 1 cut(s) 189
BsmBI CGTCTC 1 cut(s) 189
Bsp143I GATC 1 cut(s) 80
BspACI CCGC 1 cut(s) 98
BspCNI CTCAG 1 cut(s) 10
BspMAI CTGCAG 1 cut(s) 160
BspPI GGATC 1 cut(s) 88
BssECI CCNNGG 1 cut(s) 215
BssMI GATC 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 217
BstDEI CTNAG 1 cut(s) 18
BstKTI GATC 1 cut(s) 83
BstMAI GTCTC 1 cut(s) 189
BstMBI GATC 1 cut(s) 80
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstNI CCWGG 1 cut(s) 217
BstNSI RCATGY 1 cut(s) 177
BstSCI CCNGG 1 cut(s) 215
BstSFI CTRYAG 1 cut(s) 156
BstV1I GCAGC 3 cut(s) 142, 170, 190
BstX2I RGATCY 1 cut(s) 80
BstYI RGATCY 1 cut(s) 80
Csp6I GTAC 2 cut(s) 111, 171
CviAII CATG 2 cut(s) 59, 174
CviJI RGCY 7 cut(s) 9, 97, 149, 155, 203, 235, 256
CviKI_1 RGCY 7 cut(s) 9, 97, 149, 155, 203, 235, 256
CviQI GTAC 2 cut(s) 111, 171
DdeI CTNAG 1 cut(s) 18
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
Eco57I CTGAAG 4 cut(s) 135, 171, 215, 229
EcoRII CCWGG 1 cut(s) 215
Esp3I CGTCTC 1 cut(s) 189
FaeI CATG 2 cut(s) 62, 177
FaiI YATR 2 cut(s) 60, 175
FatI CATG 2 cut(s) 58, 173
Fnu4HI GCNGC 4 cut(s) 98, 156, 159, 204
Fsp4HI GCNGC 4 cut(s) 98, 156, 159, 204
GluI GCNGC 4 cut(s) 98, 156, 159, 204
Hin1II CATG 2 cut(s) 62, 177
HinfI GANTC 2 cut(s) 220, 226
Hpy188I TCNGA 2 cut(s) 225, 241
Hpy188III TCNNGA 1 cut(s) 126
HpyCH4V TGCA 4 cut(s) 4, 41, 158, 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpyF3I CTNAG 1 cut(s) 18
Hsp92II CATG 2 cut(s) 62, 177
Kzo9I GATC 1 cut(s) 80
LpnPI CCDG 4 cut(s) 107, 148, 202, 229
Lsp1109I GCAGC 3 cut(s) 142, 170, 190
MaeIII GTNAC 2 cut(s) 46, 248
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MboII GAAGA 2 cut(s) 75, 221
MflI RGATCY 1 cut(s) 80
MluCI AATT 1 cut(s) 210
MmeI TCCRAC 1 cut(s) 264
MnlI CCTC 1 cut(s) 13
MspR9I CCNGG 1 cut(s) 217
MvaI CCWGG 1 cut(s) 217
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 1 cut(s) 80
NlaIII CATG 2 cut(s) 62, 177
NspI RCATGY 1 cut(s) 177
PfeI GAWTC 2 cut(s) 220, 226
PkrI GCNGC 4 cut(s) 99, 157, 160, 205
Psp6I CCWGG 1 cut(s) 215
PspGI CCWGG 1 cut(s) 215
PstI CTGCAG 1 cut(s) 160
PsuI RGATCY 1 cut(s) 80
RsaI GTAC 2 cut(s) 112, 172
RsaNI GTAC 2 cut(s) 111, 171
SatI GCNGC 4 cut(s) 98, 156, 159, 204
Sau3AI GATC 1 cut(s) 80
ScaI AGTACT 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 217
SetI ASST 5 cut(s) 24, 157, 205, 237, 258
SfcI CTRYAG 1 cut(s) 156
Sse9I AATT 1 cut(s) 210
SsiI CCGC 1 cut(s) 98
SspI AATATT 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 215
TasI AATT 1 cut(s) 210
TatI WGTACW 1 cut(s) 110
TauI GCSGC 1 cut(s) 100
TfiI GAWTC 2 cut(s) 220, 226
TseI GCWGC 3 cut(s) 155, 158, 203
XceI RCATGY 1 cut(s) 177
ZrmI AGTACT 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.