Rroxscaffold_5G00361230

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
41879690 .. 41881434
1745 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00361230.1

Sequence Viewer

Length: 207 bp
ATGAAGAAGATGTTACTTGACTTCATGAAAAATAAGTGTGTATGTATGACTTTTGACTTCAATACAATTTTAAGACGGATCCTAGGATTACTTAACCCAGCAAAAGCAGGAGTAGATTATTTACAGTCATTGCTTCAGCACCTTCAATTACAGTTGACTGGTTTTCCCATACTTGAGGAGGTTTGGAATGATGATACTCAATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.98

Weight (kDa)

6.52

Isoelectric Point (pI)

70.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024949)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0417751
rosa_roxburghii Rroxscaffold_5G00361230
rosa_wichuraiana Rw4G017940

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 73, 86
AcuI CTGAAG 1 cut(s) 119
AgsI TTSAA 2 cut(s) 61, 146
AlwI GGATC 2 cut(s) 73, 86
AspA2I CCTAGG 1 cut(s) 82
AvrII CCTAGG 1 cut(s) 82
BamHI GGATCC 1 cut(s) 78
BfaI CTAG 1 cut(s) 83
BlnI CCTAGG 1 cut(s) 82
BmiI GGNNCC 1 cut(s) 80
BpuEI CTTGAG 1 cut(s) 194
BsaJI CCNNGG 1 cut(s) 82
Bse1I ACTGG 1 cut(s) 163
Bse3DI GCAATG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 82
BseMI GCAATG 1 cut(s) 128
BseNI ACTGG 1 cut(s) 163
BseRI GAGGAG 1 cut(s) 191
BseYI CCCAGC 1 cut(s) 97
Bsp143I GATC 1 cut(s) 78
BspHI TCATGA 1 cut(s) 24
BspLI GGNNCC 1 cut(s) 80
BspPI GGATC 2 cut(s) 73, 86
BsrDI GCAATG 1 cut(s) 128
BsrI ACTGG 1 cut(s) 163
BssECI CCNNGG 1 cut(s) 82
BssMI GATC 1 cut(s) 78
BssT1I CCWWGG 1 cut(s) 82
Bst4CI ACNGT 2 cut(s) 126, 153
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstX2I RGATCY 1 cut(s) 78
BstYI RGATCY 1 cut(s) 78
CciI TCATGA 1 cut(s) 24
CviAII CATG 1 cut(s) 25
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
Eco130I CCWWGG 1 cut(s) 82
Eco57I CTGAAG 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 82
ErhI CCWWGG 1 cut(s) 82
FaeI CATG 1 cut(s) 28
FaiI YATR 4 cut(s) 26, 43, 47, 170
FatI CATG 1 cut(s) 24
FspBI CTAG 1 cut(s) 83
GsaI CCCAGC 1 cut(s) 101
Hin1II CATG 1 cut(s) 28
HincII GTYRAC 1 cut(s) 156
HindII GTYRAC 1 cut(s) 156
Hpy166II GTNNAC 1 cut(s) 156
Hpy188III TCNNGA 1 cut(s) 25
Hpy8I GTNNAC 1 cut(s) 156
HpyAV CCTTC 1 cut(s) 152
HpyCH4III ACNGT 2 cut(s) 126, 153
Hsp92II CATG 1 cut(s) 28
Kzo9I GATC 1 cut(s) 78
LpnPI CCDG 3 cut(s) 93, 111, 144
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 1 cut(s) 12
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 2 cut(s) 16, 19
MflI RGATCY 1 cut(s) 78
MluCI AATT 2 cut(s) 66, 146
MnlI CCTC 2 cut(s) 169, 172
MseI TTAA 3 cut(s) 71, 93, 205
NdeII GATC 1 cut(s) 78
NlaIII CATG 1 cut(s) 28
NlaIV GGNNCC 1 cut(s) 80
PagI TCATGA 1 cut(s) 24
PspFI CCCAGC 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 80
PsuI RGATCY 1 cut(s) 78
SaqAI TTAA 3 cut(s) 71, 93, 205
Sau3AI GATC 1 cut(s) 78
SetI ASST 2 cut(s) 144, 183
SgeI CNNG 7 cut(s) 29, 37, 95, 110, 120, 171, 185
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 2 cut(s) 66, 146
SspI AATATT 1 cut(s) 203
SspMI CTAG 1 cut(s) 83
StyI CCWWGG 1 cut(s) 82
TaaI ACNGT 2 cut(s) 126, 153
TasI AATT 2 cut(s) 66, 146
Tru1I TTAA 3 cut(s) 71, 93, 205
Tru9I TTAA 3 cut(s) 71, 93, 205
TspDTI ATGAA 3 cut(s) 13, 17, 41
TspGWI ACGGA 1 cut(s) 91
XmaJI CCTAGG 1 cut(s) 82
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.