Rroxscaffold_7G00194580

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
36512367 .. 36517127
4761 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00194580.1

Sequence Viewer

Length: 156 bp
ATGTTCGTTCTGGTCAGAGGAGATATATGTTTAATTTTATCAATTTTATATCTTGAGTTTGATTCTTCAAAATTCTGGCTGGACCAATCTCTCTCAACTTCTCAGAACATGTGCAAGGGAAGCACAGTACAATCAACTTCAGATTATCATATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.82

Weight (kDa)

4.75

Isoelectric Point (pI)

62.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029659)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0342891
rosa_roxburghii Rroxscaffold_7G00194580

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 71
AcuI CTGAAG 1 cut(s) 123
AfaI GTAC 1 cut(s) 129
AflIII ACRYGT 1 cut(s) 108
AgsI TTSAA 1 cut(s) 69
ApoI RAATTY 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 82
AvaII GGWCC 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 82
BmgT120I GGNCC 1 cut(s) 82
BpuEI CTTGAG 1 cut(s) 74
BseMII CTCAG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 33
BspCNI CTCAG 1 cut(s) 115
Bst4CI ACNGT 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 102
BstMWI GCNNNNNNNGC 1 cut(s) 120
BstNSI RCATGY 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 82
Csp6I GTAC 1 cut(s) 128
CviAII CATG 1 cut(s) 109
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
CviQI GTAC 1 cut(s) 128
DdeI CTNAG 1 cut(s) 102
Eco47I GGWCC 1 cut(s) 82
Eco57I CTGAAG 1 cut(s) 123
FaeI CATG 1 cut(s) 112
FaiI YATR 7 cut(s) 26, 28, 49, 110, 150, 152, 154
FatI CATG 1 cut(s) 108
FspEI CC 6 cut(s) 3, 61, 65, 98, 101, 102
Hin1II CATG 1 cut(s) 112
HinfI GANTC 1 cut(s) 62
Hpy188I TCNGA 3 cut(s) 17, 105, 142
Hpy188III TCNNGA 1 cut(s) 53
HpyCH4III ACNGT 1 cut(s) 127
HpyCH4V TGCA 1 cut(s) 114
HpyF10VI GCNNNNNNNGC 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 1 cut(s) 112
LpnPI CCDG 2 cut(s) 61, 65
MboII GAAGA 1 cut(s) 57
MluCI AATT 3 cut(s) 33, 42, 71
MnlI CCTC 1 cut(s) 11
MseI TTAA 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 120
NlaIII CATG 1 cut(s) 112
NspI RCATGY 1 cut(s) 112
PciI ACATGT 1 cut(s) 108
PfeI GAWTC 1 cut(s) 62
PscI ACATGT 1 cut(s) 108
PspPI GGNCC 1 cut(s) 82
RsaI GTAC 1 cut(s) 129
RsaNI GTAC 1 cut(s) 128
SaqAI TTAA 1 cut(s) 32
Sau96I GGNCC 1 cut(s) 82
SgeI CNNG 6 cut(s) 23, 65, 88, 92, 121, 127
SinI GGWCC 1 cut(s) 82
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 3 cut(s) 33, 42, 71
TaaI ACNGT 1 cut(s) 127
TasI AATT 3 cut(s) 33, 42, 71
TatI WGTACW 1 cut(s) 127
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
VpaK11BI GGWCC 1 cut(s) 82
XapI RAATTY 1 cut(s) 71
XceI RCATGY 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.