Rh1AG053800

urease accessory protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0024780
Physical Location & Seq
Reverse (-)
8942856 .. 8944923
2068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG053800.1

Sequence Viewer

Length: 336 bp
ATGTTGGATGCAATGCTAACTAATGAAGTGGGAAAGACATCAATAACACAAGGGTCTGCACTCATGAGAGTGGCTGCAGCAGTGTATTCAGAAATATCATCTCTTAAATTTATGAGGGAAACTTCTTTAAGTAATGGAGTTGTTTCTTTTCACCATGCTCCTATTTTTGGGCTTATATGTGGATTGCTTGGGTTGTATAGCAGTACTACTCAAAGAGCTTTCATGTTTATCACGATGAGATATGTTATTTCTGCTGCAACAAGGCTGAATTTGGTCGGCCCCTTGGTGCGGCTGTTCTGCAACATCATATTCGTCCTATCTCTGAAGCTATACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0006807 GO:0008150 GO:0008152 GO:0043085 GO:0044093 GO:0050790 GO:0051336 GO:0051345 GO:0065007 GO:0065009 GO:1905181 GO:1905182
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UreF

Protein Analysis

111

Amino Acids

12.2

Weight (kDa)

9.69

Isoelectric Point (pI)

10.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UreF PF01730 5 - 95 3e-13 UreF
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024780)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0322581
rosa_multiflora Rmu_sc0002263.1_g000031
rosa_samantha Rh1AG053800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 289
AcsI RAATTY 2 cut(s) 107, 268
AfaI GTAC 1 cut(s) 205
AfiI CCNNNNNNNGG 2 cut(s) 167, 288
AluBI AGCT 2 cut(s) 218, 328
AluI AGCT 2 cut(s) 218, 328
AoxI GGCC 1 cut(s) 277
ApeKI GCWGC 3 cut(s) 74, 77, 254
ApoI RAATTY 2 cut(s) 107, 268
AspS9I GGNCC 1 cut(s) 278
AsuHPI GGTGA 1 cut(s) 143
BbvI GCAGC 3 cut(s) 61, 89, 241
BfmI CTRYAG 1 cut(s) 75
BisI GCNGC 4 cut(s) 75, 78, 255, 290
BlsI GCNGC 4 cut(s) 76, 79, 256, 291
BmcAI AGTACT 1 cut(s) 205
BmgT120I GGNCC 1 cut(s) 278
BmiI GGNNCC 1 cut(s) 280
BsaJI CCNNGG 1 cut(s) 282
Bsc4I CCNNNNNNNGG 2 cut(s) 167, 288
Bse3DI GCAATG 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 282
BseGI GGATG 1 cut(s) 13
BseLI CCNNNNNNNGG 2 cut(s) 167, 288
BseMI GCAATG 1 cut(s) 18
BseXI GCAGC 3 cut(s) 61, 89, 241
BsgI GTGCAG 1 cut(s) 42
BshFI GGCC 1 cut(s) 279
BslI CCNNNNNNNGG 2 cut(s) 167, 288
BsnI GGCC 1 cut(s) 279
BspACI CCGC 1 cut(s) 289
BspANI GGCC 1 cut(s) 279
BspHI TCATGA 1 cut(s) 63
BspLI GGNNCC 1 cut(s) 280
BspMAI CTGCAG 1 cut(s) 79
BsrDI GCAATG 1 cut(s) 18
BssECI CCNNGG 1 cut(s) 282
BssT1I CCWWGG 1 cut(s) 282
BstF5I GGATG 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 75
BstV1I GCAGC 3 cut(s) 61, 89, 241
BsuRI GGCC 1 cut(s) 279
BtsCI GGATG 1 cut(s) 13
BtsI GCAGTG 1 cut(s) 87
BtsIMutI CAGTG 1 cut(s) 87
CciI TCATGA 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 278
Csp6I GTAC 1 cut(s) 204
CviAII CATG 3 cut(s) 64, 155, 223
CviJI RGCY 7 cut(s) 74, 172, 218, 265, 279, 292, 328
CviKI_1 RGCY 7 cut(s) 74, 172, 218, 265, 279, 292, 328
CviQI GTAC 1 cut(s) 204
Eco130I CCWWGG 1 cut(s) 282
EcoT14I CCWWGG 1 cut(s) 282
ErhI CCWWGG 1 cut(s) 282
FaeI CATG 3 cut(s) 67, 158, 226
FatI CATG 3 cut(s) 63, 154, 222
Fnu4HI GCNGC 4 cut(s) 75, 78, 255, 290
FokI GGATG 1 cut(s) 20
Fsp4HI GCNGC 4 cut(s) 75, 78, 255, 290
GluI GCNGC 4 cut(s) 75, 78, 255, 290
HaeIII GGCC 1 cut(s) 279
Hin1II CATG 3 cut(s) 67, 158, 226
HphI GGTGA 1 cut(s) 143
Hpy188I TCNGA 2 cut(s) 91, 324
Hpy188III TCNNGA 2 cut(s) 64, 232
HpyCH4V TGCA 5 cut(s) 11, 59, 77, 257, 300
Hsp92II CATG 3 cut(s) 67, 158, 226
LmnI GCTCC 1 cut(s) 163
Lsp1109I GCAGC 3 cut(s) 61, 89, 241
MluCI AATT 2 cut(s) 107, 268
MnlI CCTC 1 cut(s) 108
MseI TTAA 2 cut(s) 105, 128
MslI CAYNNNNRTG 1 cut(s) 68
NlaIII CATG 3 cut(s) 67, 158, 226
NlaIV GGNNCC 1 cut(s) 280
PagI TCATGA 1 cut(s) 63
PkrI GCNGC 4 cut(s) 76, 79, 256, 291
PspN4I GGNNCC 1 cut(s) 280
PspPI GGNCC 1 cut(s) 278
PstI CTGCAG 1 cut(s) 79
RsaI GTAC 1 cut(s) 205
RsaNI GTAC 1 cut(s) 204
RseI CAYNNNNRTG 1 cut(s) 68
SaqAI TTAA 2 cut(s) 105, 128
SatI GCNGC 4 cut(s) 75, 78, 255, 290
Sau96I GGNCC 1 cut(s) 278
ScaI AGTACT 1 cut(s) 205
SetI ASST 2 cut(s) 220, 330
SfcI CTRYAG 1 cut(s) 75
SgeI CNNG 8 cut(s) 62, 76, 167, 200, 235, 244, 273, 295
SmiMI CAYNNNNRTG 1 cut(s) 68
Sse9I AATT 2 cut(s) 107, 268
SsiI CCGC 1 cut(s) 289
StyI CCWWGG 1 cut(s) 282
TasI AATT 2 cut(s) 107, 268
TatI WGTACW 1 cut(s) 203
TauI GCSGC 1 cut(s) 292
Tru1I TTAA 2 cut(s) 105, 128
Tru9I TTAA 2 cut(s) 105, 128
TscAI CASTG 1 cut(s) 87
TseI GCWGC 3 cut(s) 74, 77, 254
TspDTI ATGAA 2 cut(s) 39, 211
TspRI CASTG 1 cut(s) 87
XapI RAATTY 2 cut(s) 107, 268
ZrmI AGTACT 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.