Rh1DG269000

C-terminal binding protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
48510522 .. 48510770
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG269000.1

Sequence Viewer

Length: 249 bp
ATGAGTGGCACAGATCAAGCGTTTAGTTCCAGTTCTCGGTTTGCTTCCCCTGAAGACTCAAGAAGTAGGAAAACACCTATAGATTCAATGCAAGAGTCGCCTTCCGACCAGCTTCTAAAATCCAGAAAGAGGCTGAGTGGAAAGCCTGGTGAACTGTTAAGGGATGGCTATGTTGTAGCTCTATATGCAAGAGATATCCTGGTCTTCATGTCGCAAGGCAAAGAGTTAAAGGTGGTGGTTGGTTCCTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.01

Weight (kDa)

9.52

Isoelectric Point (pI)

72.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029692)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0357991
rosa_samantha Rh1DG269000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 72
AfiI CCNNNNNNNGG 2 cut(s) 36, 129
AgsI TTSAA 1 cut(s) 87
AjnI CCWGG 2 cut(s) 145, 198
AluBI AGCT 2 cut(s) 112, 179
AluI AGCT 2 cut(s) 112, 179
AsuHPI GGTGA 1 cut(s) 161
BbsI GAAGAC 2 cut(s) 60, 196
BccI CCATC 1 cut(s) 158
BciT130I CCWGG 2 cut(s) 147, 200
BfaI CTAG 1 cut(s) 247
BfmI CTRYAG 1 cut(s) 78
Bme1390I CCNGG 2 cut(s) 147, 200
BmiI GGNNCC 1 cut(s) 244
BmrFI CCNGG 2 cut(s) 147, 200
BpiI GAAGAC 2 cut(s) 60, 196
BpuEI CTTGAG 1 cut(s) 43
Bsc4I CCNNNNNNNGG 2 cut(s) 36, 129
Bse1I ACTGG 1 cut(s) 30
BseBI CCWGG 2 cut(s) 147, 200
BseGI GGATG 1 cut(s) 169
BseLI CCNNNNNNNGG 2 cut(s) 36, 129
BseMII CTCAG 1 cut(s) 125
BseNI ACTGG 1 cut(s) 30
BslI CCNNNNNNNGG 2 cut(s) 36, 129
Bsp143I GATC 1 cut(s) 13
BspCNI CTCAG 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 244
BsrI ACTGG 1 cut(s) 30
BssMI GATC 1 cut(s) 13
Bst2UI CCWGG 2 cut(s) 147, 200
Bst4CI ACNGT 1 cut(s) 156
BstDEI CTNAG 1 cut(s) 134
BstF5I GGATG 1 cut(s) 169
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstMWI GCNNNNNNNGC 2 cut(s) 97, 185
BstNI CCWGG 2 cut(s) 147, 200
BstSCI CCNGG 2 cut(s) 145, 198
BstSFI CTRYAG 1 cut(s) 78
BstV2I GAAGAC 2 cut(s) 60, 196
BtsCI GGATG 1 cut(s) 169
CviAII CATG 1 cut(s) 208
CviJI RGCY 5 cut(s) 112, 133, 145, 168, 179
CviKI_1 RGCY 5 cut(s) 112, 133, 145, 168, 179
DdeI CTNAG 1 cut(s) 134
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
Eco32I GATATC 1 cut(s) 196
Eco57I CTGAAG 1 cut(s) 72
EcoRII CCWGG 2 cut(s) 145, 198
EcoRV GATATC 1 cut(s) 196
FaeI CATG 1 cut(s) 211
FaiI YATR 5 cut(s) 80, 171, 184, 186, 209
FatI CATG 1 cut(s) 207
FokI GGATG 1 cut(s) 176
FspBI CTAG 1 cut(s) 247
Hin1II CATG 1 cut(s) 211
HinfI GANTC 3 cut(s) 56, 83, 95
HphI GGTGA 1 cut(s) 161
Hpy166II GTNNAC 1 cut(s) 152
Hpy188I TCNGA 1 cut(s) 106
Hpy188III TCNNGA 2 cut(s) 60, 123
Hpy8I GTNNAC 1 cut(s) 152
HpyAV CCTTC 1 cut(s) 111
HpyCH4III ACNGT 1 cut(s) 156
HpyCH4V TGCA 2 cut(s) 91, 188
HpyF10VI GCNNNNNNNGC 2 cut(s) 97, 185
HpyF3I CTNAG 1 cut(s) 134
Hsp92II CATG 1 cut(s) 211
Kzo9I GATC 1 cut(s) 13
LpnPI CCDG 8 cut(s) 43, 63, 122, 132, 136, 159, 185, 212
MaeI CTAG 1 cut(s) 247
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 2 cut(s) 65, 196
MlyI GAGTC 2 cut(s) 50, 104
MmeI TCCRAC 1 cut(s) 129
MnlI CCTC 1 cut(s) 123
MseI TTAA 2 cut(s) 158, 227
MspR9I CCNGG 2 cut(s) 147, 200
MvaI CCWGG 2 cut(s) 147, 200
MwoI GCNNNNNNNGC 2 cut(s) 97, 185
NdeII GATC 1 cut(s) 13
NlaIII CATG 1 cut(s) 211
NlaIV GGNNCC 1 cut(s) 244
PfeI GAWTC 1 cut(s) 83
PleI GAGTC 2 cut(s) 50, 103
PpsI GAGTC 2 cut(s) 50, 103
Psp6I CCWGG 2 cut(s) 145, 198
PspGI CCWGG 2 cut(s) 145, 198
PspN4I GGNNCC 1 cut(s) 244
SaqAI TTAA 2 cut(s) 158, 227
Sau3AI GATC 1 cut(s) 13
SchI GAGTC 2 cut(s) 50, 104
ScrFI CCNGG 2 cut(s) 147, 200
SetI ASST 4 cut(s) 79, 114, 181, 234
SfcI CTRYAG 1 cut(s) 78
SmlI CTYRAG 1 cut(s) 58
SmoI CTYRAG 1 cut(s) 58
SspMI CTAG 1 cut(s) 247
StyD4I CCNGG 2 cut(s) 145, 198
TaaI ACNGT 1 cut(s) 156
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 2 cut(s) 158, 227
Tru9I TTAA 2 cut(s) 158, 227
TspDTI ATGAA 1 cut(s) 196
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.