Rh2BG439800

Belongs to the peptidase C1 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
62320215 .. 62322481
2267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG439800.1

Sequence Viewer

Length: 207 bp
ATGGAAGGAATCATTCAACTTACTACAGGTAAACTAATCTCTTTGTCTGAGCAAGAGCTGGTTGACTGTGATGTGAATGGTGAAGACCAAGGTTGTGAGGGTGGCTTGATGGACAACGCATTTGAGTTCATCAATCAAAATCATGGACTTGGTACTGAGGCTAATTACCCCTACACTGGTGTTGATGCCTCTTACCCCACTGCATAA

Protein Analysis

68

Amino Acids

7.29

Weight (kDa)

4.05

Isoelectric Point (pI)

13.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_C1 PF00112 1 - 62 2.7e-19 Papain family cysteine protease
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029717)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0143161
rosa_samantha Rh2BG439800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 154
AfiI CCNNNNNNNGG 1 cut(s) 176
AgsI TTSAA 1 cut(s) 17
AluBI AGCT 1 cut(s) 58
AluI AGCT 1 cut(s) 58
ArsI GACNNNNNNTTYG 2 cut(s) 104, 136
AsuHPI GGTGA 1 cut(s) 92
BbsI GAAGAC 1 cut(s) 90
BccI CCATC 1 cut(s) 103
BfmI CTRYAG 1 cut(s) 24
BmsI GCATC 1 cut(s) 175
BpiI GAAGAC 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 88
Bsc4I CCNNNNNNNGG 1 cut(s) 176
Bse1I ACTGG 1 cut(s) 181
BseDI CCNNGG 1 cut(s) 88
BseLI CCNNNNNNNGG 1 cut(s) 176
BseMII CTCAG 2 cut(s) 39, 147
BseNI ACTGG 1 cut(s) 181
BslI CCNNNNNNNGG 1 cut(s) 176
BspCNI CTCAG 2 cut(s) 40, 148
BsrI ACTGG 1 cut(s) 181
BssECI CCNNGG 1 cut(s) 88
BssT1I CCWWGG 1 cut(s) 88
Bst4CI ACNGT 1 cut(s) 68
BstDEI CTNAG 2 cut(s) 48, 156
BstSFI CTRYAG 1 cut(s) 24
BstV2I GAAGAC 1 cut(s) 90
BtsI GCAGTG 1 cut(s) 198
BtsIMutI CAGTG 2 cut(s) 174, 198
Csp6I GTAC 1 cut(s) 153
CviAII CATG 1 cut(s) 143
CviJI RGCY 3 cut(s) 58, 105, 161
CviKI_1 RGCY 3 cut(s) 58, 105, 161
CviQI GTAC 1 cut(s) 153
DdeI CTNAG 2 cut(s) 48, 156
Eco130I CCWWGG 1 cut(s) 88
EcoT14I CCWWGG 1 cut(s) 88
ErhI CCWWGG 1 cut(s) 88
FaeI CATG 1 cut(s) 146
FaiI YATR 2 cut(s) 144, 205
FatI CATG 1 cut(s) 142
Hin1II CATG 1 cut(s) 146
HincII GTYRAC 1 cut(s) 64
HindII GTYRAC 1 cut(s) 64
HinfI GANTC 1 cut(s) 9
HphI GGTGA 1 cut(s) 92
Hpy166II GTNNAC 2 cut(s) 32, 64
Hpy188I TCNGA 1 cut(s) 49
Hpy8I GTNNAC 2 cut(s) 32, 64
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 1 cut(s) 203
HpyF3I CTNAG 2 cut(s) 48, 156
Hsp92II CATG 1 cut(s) 146
LpnPI CCDG 3 cut(s) 12, 44, 162
LweI GCATC 1 cut(s) 175
MboII GAAGA 1 cut(s) 95
MluCI AATT 1 cut(s) 163
MnlI CCTC 3 cut(s) 91, 151, 199
NlaIII CATG 1 cut(s) 146
PfeI GAWTC 1 cut(s) 9
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SetI ASST 3 cut(s) 31, 60, 94
SfaNI GCATC 1 cut(s) 175
SfcI CTRYAG 1 cut(s) 24
SgeI CNNG 8 cut(s) 39, 65, 71, 101, 118, 155, 161, 189
Sse9I AATT 1 cut(s) 163
StyI CCWWGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 68
TasI AATT 1 cut(s) 163
TfiI GAWTC 1 cut(s) 9
TscAI CASTG 2 cut(s) 181, 205
TspDTI ATGAA 1 cut(s) 118
TspRI CASTG 2 cut(s) 181, 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.