Rh2CG435400

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
59110429 .. 59110737
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG435400.1

Sequence Viewer

Length: 309 bp
ATGCCAACTTGCCAAGCCGATGTCCCAATGATCTCCATGAGGAATATCAGTTTCAGAATTCTTGACATGAGCAATATTAGTACTACAACAACTCCTACTCTAAAAGTTGCTAGGGAGGATTGCTGGGGAACTATCTGTCCCTCGACATATTATCCCACAAACCTCGACTTCTCTCTCTTCACCTACTCTTCTGGGCTTCTGAACGTGTCTTTTTGGTACGGGTGCAACACAAACGTAACAGTCACAAGTAATTCTCATGTCTGCAACAGCAGCGGCAATGCTTCCTATCTCACACAGCTAGTAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

102

Amino Acids

11.28

Weight (kDa)

5.45

Isoelectric Point (pI)

31.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0033914)

Species Orthologous Gene IDs
rosa_samantha Rh2AG448400 Rh2CG435400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 273
AcsI RAATTY 1 cut(s) 57
AfaI GTAC 2 cut(s) 82, 218
AflIII ACRYGT 1 cut(s) 204
AloI GAACNNNNNNTCC 2 cut(s) 121, 153
AluBI AGCT 1 cut(s) 298
AluI AGCT 1 cut(s) 298
ApeKI GCWGC 1 cut(s) 270
ApoI RAATTY 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 172
BbvI GCAGC 1 cut(s) 282
BfaI CTAG 2 cut(s) 111, 299
BisI GCNGC 2 cut(s) 271, 274
BlsI GCNGC 2 cut(s) 272, 275
BmcAI AGTACT 1 cut(s) 82
BsaXI ACNNNNNCTCC 2 cut(s) 76, 106
Bse3DI GCAATG 1 cut(s) 283
BseMI GCAATG 1 cut(s) 283
BseXI GCAGC 1 cut(s) 282
BseYI CCCAGC 1 cut(s) 123
BslFI GGGAC 2 cut(s) 8, 123
BsmFI GGGAC 2 cut(s) 8, 123
Bsp143I GATC 1 cut(s) 30
BspACI CCGC 1 cut(s) 273
BsrDI GCAATG 1 cut(s) 283
BssMI GATC 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 241
Bst6I CTCTTC 2 cut(s) 182, 193
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 270
BstV1I GCAGC 1 cut(s) 282
Csp6I GTAC 2 cut(s) 81, 217
CviAII CATG 3 cut(s) 37, 67, 257
CviJI RGCY 3 cut(s) 17, 196, 298
CviKI_1 RGCY 3 cut(s) 17, 196, 298
CviQI GTAC 2 cut(s) 81, 217
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
Eam1104I CTCTTC 2 cut(s) 182, 193
EarI CTCTTC 2 cut(s) 182, 193
EcoRI GAATTC 1 cut(s) 57
FaeI CATG 3 cut(s) 40, 70, 260
FaiI YATR 4 cut(s) 38, 68, 148, 258
FaqI GGGAC 2 cut(s) 8, 123
FatI CATG 3 cut(s) 36, 66, 256
Fnu4HI GCNGC 2 cut(s) 271, 274
Fsp4HI GCNGC 2 cut(s) 271, 274
FspBI CTAG 2 cut(s) 111, 299
GluI GCNGC 2 cut(s) 271, 274
GsaI CCCAGC 1 cut(s) 127
Hin1II CATG 3 cut(s) 40, 70, 260
HphI GGTGA 1 cut(s) 172
Hpy188I TCNGA 2 cut(s) 56, 201
Hpy188III TCNNGA 1 cut(s) 62
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4IV ACGT 2 cut(s) 204, 234
HpyCH4V TGCA 2 cut(s) 225, 264
HpyF10VI GCNNNNNNNGC 1 cut(s) 270
HpySE526I ACGT 2 cut(s) 204, 234
Hsp92II CATG 3 cut(s) 40, 70, 260
Kzo9I GATC 1 cut(s) 30
LpnPI CCDG 2 cut(s) 109, 177
Lsp1109I GCAGC 1 cut(s) 282
MaeI CTAG 2 cut(s) 111, 299
MaeII ACGT 2 cut(s) 204, 234
MaeIII GTNAC 2 cut(s) 235, 241
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MboII GAAGA 2 cut(s) 169, 180
MluCI AATT 3 cut(s) 57, 250, 304
MnlI CCTC 4 cut(s) 33, 109, 151, 173
MspA1I CMGCKG 1 cut(s) 273
MwoI GCNNNNNNNGC 1 cut(s) 270
NdeII GATC 1 cut(s) 30
NlaIII CATG 3 cut(s) 40, 70, 260
NmuCI GTSAC 1 cut(s) 241
PkrI GCNGC 2 cut(s) 272, 275
PspFI CCCAGC 1 cut(s) 123
RsaI GTAC 2 cut(s) 82, 218
RsaNI GTAC 2 cut(s) 81, 217
SatI GCNGC 2 cut(s) 271, 274
Sau3AI GATC 1 cut(s) 30
ScaI AGTACT 1 cut(s) 82
SetI ASST 5 cut(s) 165, 185, 207, 237, 300
Sse9I AATT 3 cut(s) 57, 250, 304
SsiI CCGC 1 cut(s) 273
SspI AATATT 1 cut(s) 76
SspMI CTAG 2 cut(s) 111, 299
TaaI ACNGT 1 cut(s) 241
TaiI ACGT 2 cut(s) 207, 237
TaqI TCGA 2 cut(s) 143, 165
TasI AATT 3 cut(s) 57, 250, 304
TatI WGTACW 1 cut(s) 80
TauI GCSGC 1 cut(s) 276
TseFI GTSAC 1 cut(s) 241
TseI GCWGC 1 cut(s) 270
Tsp45I GTSAC 1 cut(s) 241
XapI RAATTY 1 cut(s) 57
XspI CTAG 2 cut(s) 111, 299
ZrmI AGTACT 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.