Rh2DG013400

hemolysis in other organism

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
722523 .. 723577
1055 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG013400.1

Sequence Viewer

Length: 420 bp
ATGAGTGTCTATTTGACTGTGATGACGTTCAATCTTCATGAAGATCCGACAGCAGATAGTTCTAATTCATGGGAAAAGAGAAGAGATTTGTGTATAAGCGTCGTTACTAATTATTCTCCGATGATTCTCTGTACTCAACAAGGAGCTAAATCACAATTGGATTATCTTCAACAATGCTTGCCAGGTTATGACCAATTTGGGATATCAAGAAAAGGACCTGAAGACACTTCAGACGAACATTGCACCATCTTCTATGACAAGGAGAAGGTGGAGGTTATTGAAGGTGGAACATTTTGGTTGTCAGAGTCACCTTCTGTCCCTGGAAGCATGTCGTGGGGTGCTCTAGTTCCATGTATTGCTACATGGGTGATATCCTTGCCATTTTTCTTTCTCCATAATTGTTCGTTGTTGACTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.6

Weight (kDa)

4.6

Isoelectric Point (pI)

61.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029788)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0085621
rosa_samantha Rh2DG013400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 38
AcuI CTGAAG 2 cut(s) 213, 240
AfaI GTAC 1 cut(s) 133
AgsI TTSAA 3 cut(s) 31, 170, 281
AjnI CCWGG 2 cut(s) 181, 319
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw21I GWGCWC 1 cut(s) 343
AlwI GGATC 1 cut(s) 38
AspS9I GGNCC 1 cut(s) 215
AsuHPI GGTGA 2 cut(s) 300, 379
AvaII GGWCC 1 cut(s) 215
BbsI GAAGAC 1 cut(s) 228
Bbv12I GWGCWC 1 cut(s) 343
BccI CCATC 1 cut(s) 254
BciT130I CCWGG 2 cut(s) 183, 321
BfaI CTAG 1 cut(s) 344
Bme1390I CCNGG 2 cut(s) 183, 321
Bme18I GGWCC 1 cut(s) 215
BmgT120I GGNCC 1 cut(s) 215
BmrFI CCNGG 2 cut(s) 183, 321
BpiI GAAGAC 1 cut(s) 228
BsaJI CCNNGG 1 cut(s) 319
Bse3DI GCAATG 1 cut(s) 238
BseBI CCWGG 2 cut(s) 183, 321
BseDI CCNNGG 1 cut(s) 319
BseMI GCAATG 1 cut(s) 238
BsiHKAI GWGCWC 1 cut(s) 343
BslFI GGGAC 1 cut(s) 302
BsmFI GGGAC 1 cut(s) 302
Bsp1286I GDGCHC 1 cut(s) 343
Bsp143I GATC 1 cut(s) 43
BspHI TCATGA 1 cut(s) 37
BspPI GGATC 1 cut(s) 38
BsrDI GCAATG 1 cut(s) 238
BssECI CCNNGG 1 cut(s) 319
BssMI GATC 1 cut(s) 43
Bst2UI CCWGG 2 cut(s) 183, 321
Bst4CI ACNGT 1 cut(s) 19
Bst6I CTCTTC 1 cut(s) 76
BstC8I GCNNGC 1 cut(s) 179
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstNI CCWGG 2 cut(s) 183, 321
BstNSI RCATGY 1 cut(s) 331
BstSCI CCNGG 2 cut(s) 181, 319
BstV2I GAAGAC 1 cut(s) 228
BstX2I RGATCY 1 cut(s) 43
BstYI RGATCY 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 179
CciI TCATGA 1 cut(s) 37
Cfr13I GGNCC 1 cut(s) 215
CseI GACGC 1 cut(s) 88
Csp6I GTAC 1 cut(s) 132
CviAII CATG 5 cut(s) 38, 69, 328, 351, 363
CviJI RGCY 1 cut(s) 146
CviKI_1 RGCY 1 cut(s) 146
CviQI GTAC 1 cut(s) 132
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 76
EarI CTCTTC 1 cut(s) 76
Eco32I GATATC 2 cut(s) 204, 372
Eco47I GGWCC 1 cut(s) 215
Eco57I CTGAAG 2 cut(s) 213, 240
EcoO109I RGGNCCY 1 cut(s) 215
EcoRII CCWGG 2 cut(s) 181, 319
EcoRV GATATC 2 cut(s) 204, 372
FaeI CATG 5 cut(s) 41, 72, 331, 354, 366
FaiI YATR 9 cut(s) 39, 70, 95, 189, 255, 329, 352, 364, 396
FaqI GGGAC 1 cut(s) 302
FatI CATG 5 cut(s) 37, 68, 327, 350, 362
FspBI CTAG 1 cut(s) 344
HgaI GACGC 1 cut(s) 88
Hin1II CATG 5 cut(s) 41, 72, 331, 354, 366
HincII GTYRAC 1 cut(s) 411
HindII GTYRAC 1 cut(s) 411
HinfI GANTC 2 cut(s) 124, 305
HphI GGTGA 2 cut(s) 300, 379
Hpy166II GTNNAC 1 cut(s) 411
Hpy188I TCNGA 4 cut(s) 48, 120, 232, 304
Hpy188III TCNNGA 2 cut(s) 38, 207
Hpy8I GTNNAC 1 cut(s) 411
Hpy99I CGWCG 1 cut(s) 104
HpyAV CCTTC 3 cut(s) 259, 275, 321
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4IV ACGT 1 cut(s) 26
HpyCH4V TGCA 1 cut(s) 243
HpySE526I ACGT 1 cut(s) 26
Hsp92II CATG 5 cut(s) 41, 72, 331, 354, 366
Kzo9I GATC 1 cut(s) 43
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 5 cut(s) 168, 195, 231, 306, 333
MaeI CTAG 1 cut(s) 344
MaeII ACGT 1 cut(s) 26
MaeIII GTNAC 2 cut(s) 103, 306
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 6 cut(s) 26, 53, 93, 158, 233, 241
MfeI CAATTG 1 cut(s) 155
MflI RGATCY 1 cut(s) 43
MhlI GDGCHC 1 cut(s) 343
MluCI AATT 5 cut(s) 64, 109, 155, 194, 397
MlyI GAGTC 1 cut(s) 314
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 1 cut(s) 265
MseI TTAA 1 cut(s) 418
MspR9I CCNGG 2 cut(s) 183, 321
MunI CAATTG 1 cut(s) 155
MvaI CCWGG 2 cut(s) 183, 321
NdeII GATC 1 cut(s) 43
NlaIII CATG 5 cut(s) 41, 72, 331, 354, 366
NmuCI GTSAC 1 cut(s) 306
NspI RCATGY 1 cut(s) 331
PagI TCATGA 1 cut(s) 37
PfeI GAWTC 1 cut(s) 124
PleI GAGTC 1 cut(s) 313
PpsI GAGTC 1 cut(s) 313
PpuMI RGGWCCY 1 cut(s) 215
Psp5II RGGWCCY 1 cut(s) 215
Psp6I CCWGG 2 cut(s) 181, 319
PspGI CCWGG 2 cut(s) 181, 319
PspPI GGNCC 1 cut(s) 215
PspPPI RGGWCCY 1 cut(s) 215
PsuI RGATCY 1 cut(s) 43
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
SaqAI TTAA 1 cut(s) 418
Sau3AI GATC 1 cut(s) 43
Sau96I GGNCC 1 cut(s) 215
SchI GAGTC 1 cut(s) 314
ScrFI CCNGG 2 cut(s) 183, 321
SduI GDGCHC 1 cut(s) 343
SetI ASST 8 cut(s) 29, 148, 187, 220, 270, 276, 286, 313
SinI GGWCC 1 cut(s) 215
Sse9I AATT 5 cut(s) 64, 109, 155, 194, 397
SspMI CTAG 1 cut(s) 344
StyD4I CCNGG 2 cut(s) 181, 319
TaaI ACNGT 1 cut(s) 19
TaiI ACGT 1 cut(s) 29
TasI AATT 5 cut(s) 64, 109, 155, 194, 397
TatI WGTACW 1 cut(s) 131
TfiI GAWTC 1 cut(s) 124
Tru1I TTAA 1 cut(s) 418
Tru9I TTAA 1 cut(s) 418
TseFI GTSAC 1 cut(s) 306
Tsp45I GTSAC 1 cut(s) 306
TspDTI ATGAA 3 cut(s) 26, 54, 57
VpaK11BI GGWCC 1 cut(s) 215
XceI RCATGY 1 cut(s) 331
XspI CTAG 1 cut(s) 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.