Rh3AG145700

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
12894415 .. 12896529
2115 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG145700.1

Sequence Viewer

Length: 492 bp
ATGCTTAATTTGAGAGGTAATGGATTCGTGACCGGAGTTGGTGTTCGTGCATTTTTAAGTCACAAACGCTTACAATCCCTTGATCTACGCTACATTCGGATTCATGTTAGTGGATCTGATTTGGAAGACCTAGTGCTTGCATGCCCATCATTGAAGTCTATACTGGTAGAGGGTGGATGGAGAAAAAGGTTGTTGCGTGAGATGCAAGAAAGCACTCCTAGCAGATTCGGCGAGTTTTTAAACAAGGGTAAACCGGTCACTACCATGAGGGCATTCCCAGCCAATAATGGTTCAGAAGATTCTATTAAAAGGGCTAAGAAGCTTGTTGAACTCTTGTTTCTAATGCGTCTTTCCATCCCTGTAGTAATACAAGTAGCAATCCATGACAGGCCCTGTGAAGTCATAAAGATCGGGTACTCGAATGGTGGGTTTTGCGCACGATATAAGATCGACAAGTTGGTTATTTCACTTTTGGACGCTGGGGAAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

163

Amino Acids

18.23

Weight (kDa)

9.79

Isoelectric Point (pI)

36.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025870)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_6G00412610
rosa_samantha Rh3AG145700 Rh3DG166900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 436
AclWI GGATC 1 cut(s) 121
AcsI RAATTY 1 cut(s) 486
AfaI GTAC 1 cut(s) 416
AgeI ACCGGT 1 cut(s) 253
AgsI TTSAA 2 cut(s) 154, 329
AloI GAACNNNNNNTCC 2 cut(s) 27, 59
AluBI AGCT 1 cut(s) 322
AluI AGCT 1 cut(s) 322
AlwI GGATC 1 cut(s) 121
AlwNI CAGNNNCTG 1 cut(s) 393
AoxI GGCC 1 cut(s) 389
ApoI RAATTY 1 cut(s) 486
AsiGI ACCGGT 1 cut(s) 253
AspLEI GCGC 1 cut(s) 437
AspS9I GGNCC 1 cut(s) 390
BbsI GAAGAC 1 cut(s) 132
BccI CCATC 3 cut(s) 154, 171, 362
BfaI CTAG 2 cut(s) 131, 219
BfmI CTRYAG 1 cut(s) 360
BmgT120I GGNCC 1 cut(s) 390
BmsI GCATC 1 cut(s) 192
BpiI GAAGAC 1 cut(s) 132
BsaWI WCCGGW 2 cut(s) 32, 253
BsaXI ACNNNNNCTCC 2 cut(s) 27, 57
Bse118I RCCGGY 1 cut(s) 253
Bse1I ACTGG 1 cut(s) 168
BseGI GGATG 2 cut(s) 182, 354
BseNI ACTGG 1 cut(s) 168
BseYI CCCAGC 2 cut(s) 277, 479
BshFI GGCC 1 cut(s) 391
BshTI ACCGGT 1 cut(s) 253
BsiSI CCGG 2 cut(s) 33, 254
BsmI GAATGC 1 cut(s) 272
BsnI GGCC 1 cut(s) 391
Bsp143I GATC 4 cut(s) 82, 113, 408, 447
BspANI GGCC 1 cut(s) 391
BspPI GGATC 1 cut(s) 121
BsrFI RCCGGY 1 cut(s) 253
BsrI ACTGG 1 cut(s) 168
BssAI RCCGGY 1 cut(s) 253
BssMI GATC 4 cut(s) 82, 113, 408, 447
BstC8I GCNNGC 2 cut(s) 138, 142
BstDEI CTNAG 1 cut(s) 315
BstF5I GGATG 2 cut(s) 182, 354
BstHHI GCGC 1 cut(s) 437
BstKTI GATC 4 cut(s) 85, 116, 411, 450
BstMBI GATC 4 cut(s) 82, 113, 408, 447
BstMWI GCNNNNNNNGC 4 cut(s) 202, 219, 228, 278
BstNSI RCATGY 1 cut(s) 144
BstSFI CTRYAG 1 cut(s) 360
BstV2I GAAGAC 1 cut(s) 132
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
BsuRI GGCC 1 cut(s) 391
BtsCI GGATG 2 cut(s) 182, 354
Cac8I GCNNGC 2 cut(s) 138, 142
CaiI CAGNNNCTG 1 cut(s) 393
CfoI GCGC 1 cut(s) 437
Cfr10I RCCGGY 1 cut(s) 253
Cfr13I GGNCC 1 cut(s) 390
CseI GACGC 2 cut(s) 335, 485
Csp6I GTAC 1 cut(s) 415
CspAI ACCGGT 1 cut(s) 253
CviAII CATG 4 cut(s) 104, 141, 265, 383
CviJI RGCY 4 cut(s) 281, 314, 322, 391
CviKI_1 RGCY 4 cut(s) 281, 314, 322, 391
CviQI GTAC 1 cut(s) 415
DdeI CTNAG 1 cut(s) 315
DpnI GATC 4 cut(s) 84, 115, 410, 449
DpnII GATC 4 cut(s) 82, 113, 408, 447
DraI TTTAAA 1 cut(s) 240
EcoO109I RGGNCCY 1 cut(s) 390
FaeI CATG 4 cut(s) 107, 144, 268, 386
FaiI YATR 7 cut(s) 105, 142, 161, 266, 384, 404, 444
FatI CATG 4 cut(s) 103, 140, 264, 382
FokI GGATG 2 cut(s) 189, 341
FspBI CTAG 2 cut(s) 131, 219
FspI TGCGCA 1 cut(s) 436
GlaI GCGC 1 cut(s) 436
GsaI CCCAGC 2 cut(s) 281, 483
HaeIII GGCC 1 cut(s) 391
HapII CCGG 2 cut(s) 33, 254
HgaI GACGC 2 cut(s) 335, 485
HhaI GCGC 1 cut(s) 437
Hin1II CATG 4 cut(s) 107, 144, 268, 386
Hin6I GCGC 1 cut(s) 435
HinP1I GCGC 1 cut(s) 435
HindIII AAGCTT 1 cut(s) 320
HinfI GANTC 4 cut(s) 24, 100, 225, 299
HpaII CCGG 2 cut(s) 33, 254
Hpy166II GTNNAC 1 cut(s) 251
Hpy188I TCNGA 3 cut(s) 99, 118, 295
Hpy188III TCNNGA 1 cut(s) 28
Hpy8I GTNNAC 1 cut(s) 251
HpyCH4V TGCA 3 cut(s) 50, 140, 205
HpyF10VI GCNNNNNNNGC 4 cut(s) 202, 219, 228, 278
HpyF3I CTNAG 1 cut(s) 315
Hsp92II CATG 4 cut(s) 107, 144, 268, 386
HspAI GCGC 1 cut(s) 435
Kzo9I GATC 4 cut(s) 82, 113, 408, 447
LpnPI CCDG 8 cut(s) 46, 149, 267, 291, 372, 373, 406, 465
LweI GCATC 1 cut(s) 192
MaeI CTAG 2 cut(s) 131, 219
MaeIII GTNAC 3 cut(s) 28, 59, 256
MalI GATC 4 cut(s) 84, 115, 410, 449
MboI GATC 4 cut(s) 82, 113, 408, 447
MboII GAAGA 2 cut(s) 137, 308
MflI RGATCY 1 cut(s) 113
MluCI AATT 2 cut(s) 7, 486
MnlI CCTC 3 cut(s) 8, 163, 261
MseI TTAA 4 cut(s) 6, 56, 239, 306
MslI CAYNNNNRTG 2 cut(s) 108, 263
MspI CCGG 2 cut(s) 33, 254
Mva1269I GAATGC 1 cut(s) 272
MwoI GCNNNNNNNGC 4 cut(s) 202, 219, 228, 278
NdeII GATC 4 cut(s) 82, 113, 408, 447
NlaIII CATG 4 cut(s) 107, 144, 268, 386
NmuCI GTSAC 3 cut(s) 28, 59, 256
NsbI TGCGCA 1 cut(s) 436
NspI RCATGY 1 cut(s) 144
PaeI GCATGC 1 cut(s) 144
PctI GAATGC 1 cut(s) 272
PfeI GAWTC 4 cut(s) 24, 100, 225, 299
PinAI ACCGGT 1 cut(s) 253
PspFI CCCAGC 2 cut(s) 277, 479
PspPI GGNCC 1 cut(s) 390
PstNI CAGNNNCTG 1 cut(s) 393
PsuI RGATCY 1 cut(s) 113
RsaI GTAC 1 cut(s) 416
RsaNI GTAC 1 cut(s) 415
RseI CAYNNNNRTG 2 cut(s) 108, 263
SaqAI TTAA 4 cut(s) 6, 56, 239, 306
Sau3AI GATC 4 cut(s) 82, 113, 408, 447
Sau96I GGNCC 1 cut(s) 390
SetI ASST 4 cut(s) 19, 132, 191, 324
SfaNI GCATC 1 cut(s) 192
SfcI CTRYAG 1 cut(s) 360
SmiMI CAYNNNNRTG 2 cut(s) 108, 263
SphI GCATGC 1 cut(s) 144
Sse9I AATT 2 cut(s) 7, 486
SspMI CTAG 2 cut(s) 131, 219
TaqI TCGA 2 cut(s) 419, 450
TasI AATT 2 cut(s) 7, 486
TfiI GAWTC 4 cut(s) 24, 100, 225, 299
Tru1I TTAA 4 cut(s) 6, 56, 239, 306
Tru9I TTAA 4 cut(s) 6, 56, 239, 306
TseFI GTSAC 3 cut(s) 28, 59, 256
Tsp45I GTSAC 3 cut(s) 28, 59, 256
TspDTI ATGAA 1 cut(s) 92
XapI RAATTY 1 cut(s) 486
XceI RCATGY 1 cut(s) 144
XspI CTAG 2 cut(s) 131, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.