Rh3AG218200

Ubiquitin-like domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0029907
Physical Location & Seq
Reverse (-)
22168967 .. 22178163
9197 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG218200.1

Sequence Viewer

Length: 231 bp
ATGTCAAAGCCAAGATCCAGCCATGGAATACACCCTTGTATTCAGAATAAGGAAGGCGTCCCTCCTGATCAACAGAGATTGATTTTTGCCAGTAATTGGAAGATGGTGAAGGCTCTTACTGGGAAAGAAATTGAGATTGATATAGACCCGATTGACACCATTGGCCTAATCAAGGAAAGGGTTGAGGAGAAAGAGGGAATTCCTCCGGTGCAACAAAGGAAAAAGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

76

Amino Acids

8.6

Weight (kDa)

8.85

Isoelectric Point (pI)

47.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 36 - 73 9.8e-08 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029907)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0478361
rosa_samantha Rh3AG218200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 96
AclWI GGATC 1 cut(s) 9
AcsI RAATTY 1 cut(s) 198
AcyI GRCGYC 1 cut(s) 57
AfiI CCNNNNNNNGG 2 cut(s) 96, 172
AlwI GGATC 1 cut(s) 9
AoxI GGCC 1 cut(s) 163
ApoI RAATTY 1 cut(s) 198
AsuHPI GGTGA 1 cut(s) 118
BccI CCATC 1 cut(s) 97
BclI TGATCA 1 cut(s) 67
BmrI ACTGGG 1 cut(s) 129
BmuI ACTGGG 1 cut(s) 129
BsaHI GRCGYC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 22
BsaWI WCCGGW 1 cut(s) 205
Bsc4I CCNNNNNNNGG 2 cut(s) 96, 172
Bse1I ACTGG 2 cut(s) 90, 124
BseDI CCNNGG 1 cut(s) 22
BseLI CCNNNNNNNGG 2 cut(s) 96, 172
BseNI ACTGG 2 cut(s) 90, 124
BseRI GAGGAG 1 cut(s) 200
BshFI GGCC 1 cut(s) 165
BsiSI CCGG 1 cut(s) 206
BslFI GGGAC 1 cut(s) 44
BslI CCNNNNNNNGG 2 cut(s) 96, 172
BsmFI GGGAC 1 cut(s) 44
BsnI GGCC 1 cut(s) 165
Bsp143I GATC 2 cut(s) 14, 67
Bsp19I CCATGG 1 cut(s) 22
BspANI GGCC 1 cut(s) 165
BspPI GGATC 1 cut(s) 9
BsrI ACTGG 2 cut(s) 90, 124
BssECI CCNNGG 1 cut(s) 22
BssMI GATC 2 cut(s) 14, 67
BssNI GRCGYC 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 22
BstACI GRCGYC 1 cut(s) 57
BstDSI CCRYGG 1 cut(s) 22
BstENI CCTNNNNNAGG 1 cut(s) 170
BstKTI GATC 2 cut(s) 17, 70
BstMBI GATC 2 cut(s) 14, 67
BstX2I RGATCY 1 cut(s) 14
BstYI RGATCY 1 cut(s) 14
BsuRI GGCC 1 cut(s) 165
BtgI CCRYGG 1 cut(s) 22
CseI GACGC 1 cut(s) 46
CviAII CATG 1 cut(s) 23
CviJI RGCY 5 cut(s) 10, 21, 113, 165, 227
CviKI_1 RGCY 5 cut(s) 10, 21, 113, 165, 227
DpnI GATC 2 cut(s) 16, 69
DpnII GATC 2 cut(s) 14, 67
Eco130I CCWWGG 1 cut(s) 22
EcoNI CCTNNNNNAGG 1 cut(s) 170
EcoRI GAATTC 1 cut(s) 198
EcoT14I CCWWGG 1 cut(s) 22
ErhI CCWWGG 1 cut(s) 22
FaeI CATG 1 cut(s) 26
FaiI YATR 2 cut(s) 24, 143
FaqI GGGAC 1 cut(s) 44
FatI CATG 1 cut(s) 22
FbaI TGATCA 1 cut(s) 67
HaeIII GGCC 1 cut(s) 165
HapII CCGG 1 cut(s) 206
HgaI GACGC 1 cut(s) 46
Hin1I GRCGYC 1 cut(s) 57
Hin1II CATG 1 cut(s) 26
HpaII CCGG 1 cut(s) 206
HphI GGTGA 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 65
HpyAV CCTTC 2 cut(s) 47, 103
HpyCH4V TGCA 1 cut(s) 211
Hsp92I GRCGYC 1 cut(s) 57
Hsp92II CATG 1 cut(s) 26
Ksp22I TGATCA 1 cut(s) 67
Kzo9I GATC 2 cut(s) 14, 67
LpnPI CCDG 5 cut(s) 31, 78, 103, 105, 219
MalI GATC 2 cut(s) 16, 69
MboI GATC 2 cut(s) 14, 67
MboII GAAGA 1 cut(s) 112
MflI RGATCY 1 cut(s) 14
MluCI AATT 3 cut(s) 94, 129, 198
MnlI CCTC 4 cut(s) 72, 178, 187, 213
MspI CCGG 1 cut(s) 206
NcoI CCATGG 1 cut(s) 22
NdeII GATC 2 cut(s) 14, 67
NlaIII CATG 1 cut(s) 26
PflMI CCANNNNNTGG 1 cut(s) 96
PsuI RGATCY 1 cut(s) 14
Sau3AI GATC 2 cut(s) 14, 67
Sse9I AATT 3 cut(s) 94, 129, 198
StyI CCWWGG 1 cut(s) 22
TasI AATT 3 cut(s) 94, 129, 198
Van91I CCANNNNNTGG 1 cut(s) 96
XagI CCTNNNNNAGG 1 cut(s) 170
XapI RAATTY 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.