Rh3AG336900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
49179435 .. 49181706
2272 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG336900.1

Sequence Viewer

Length: 219 bp
ATGGAATTATGGATGGACACAGTGGCTTACGATGAGTCAAGTGAGTTGAAAGTCCTGTTGCTGAGGATATGTTCCATTAGCAAGCAACAATTATGGGTCCAGCCGACAGCCCATTTATTCGAGGTGTTTTCCTTGTATCCATTCACTTCCCACTCAATTACCATTTCAAGCCACTTAAGGGAAGTCATGAATTGGGTTGAATTGGATGAGGAGACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.5

Weight (kDa)

4.59

Isoelectric Point (pI)

47.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032390)

Species Orthologous Gene IDs
rosa_rugosa Rorug05G0239800
rosa_samantha Rh3AG336900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 178
AflII CTTAAG 1 cut(s) 175
AgsI TTSAA 3 cut(s) 49, 168, 200
Alw26I GTCTC 1 cut(s) 206
AspS9I GGNCC 1 cut(s) 97
AvaII GGWCC 1 cut(s) 97
BbvCI CCTCAGC 1 cut(s) 62
BccI CCATC 1 cut(s) 7
BciVI GTATCC 1 cut(s) 147
BcoDI GTCTC 1 cut(s) 206
BfrI CTTAAG 1 cut(s) 175
BfuI GTATCC 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 97
BmiI GGNNCC 1 cut(s) 98
Bpu10I CCTNAGC 1 cut(s) 62
Bsc4I CCNNNNNNNGG 1 cut(s) 178
BseGI GGATG 2 cut(s) 18, 211
BseLI CCNNNNNNNGG 1 cut(s) 178
BseMII CTCAG 1 cut(s) 53
BslI CCNNNNNNNGG 1 cut(s) 178
BsmAI GTCTC 1 cut(s) 206
BspCNI CTCAG 1 cut(s) 54
BspHI TCATGA 1 cut(s) 186
BspLI GGNNCC 1 cut(s) 98
BspTI CTTAAG 1 cut(s) 175
Bst4CI ACNGT 1 cut(s) 22
BstAFI CTTAAG 1 cut(s) 175
BstC8I GCNNGC 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 62
BstF5I GGATG 2 cut(s) 18, 211
BstMAI GTCTC 1 cut(s) 206
BsuI GTATCC 1 cut(s) 147
BtsCI GGATG 2 cut(s) 18, 211
BtsIMutI CAGTG 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 83
CciI TCATGA 1 cut(s) 186
Cfr13I GGNCC 1 cut(s) 97
CviAII CATG 1 cut(s) 187
CviJI RGCY 4 cut(s) 26, 103, 110, 171
CviKI_1 RGCY 4 cut(s) 26, 103, 110, 171
DdeI CTNAG 1 cut(s) 62
Eco47I GGWCC 1 cut(s) 97
FaeI CATG 1 cut(s) 190
FaiI YATR 4 cut(s) 10, 70, 94, 188
FatI CATG 1 cut(s) 186
FokI GGATG 1 cut(s) 25
Hin1II CATG 1 cut(s) 190
HinfI GANTC 1 cut(s) 35
Hpy188III TCNNGA 1 cut(s) 187
HpyCH4III ACNGT 1 cut(s) 22
HpyF3I CTNAG 1 cut(s) 62
Hsp92II CATG 1 cut(s) 190
LpnPI CCDG 2 cut(s) 68, 113
MluCI AATT 5 cut(s) 5, 89, 156, 190, 200
MlyI GAGTC 1 cut(s) 44
MnlI CCTC 3 cut(s) 57, 115, 202
MseI TTAA 2 cut(s) 176, 217
MspCI CTTAAG 1 cut(s) 175
NlaIII CATG 1 cut(s) 190
NlaIV GGNNCC 1 cut(s) 98
PagI TCATGA 1 cut(s) 186
PleI GAGTC 1 cut(s) 43
PpsI GAGTC 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 98
PspPI GGNCC 1 cut(s) 97
SaqAI TTAA 2 cut(s) 176, 217
Sau96I GGNCC 1 cut(s) 97
SchI GAGTC 1 cut(s) 44
SetI ASST 1 cut(s) 126
SgeI CNNG 8 cut(s) 51, 67, 94, 112, 133, 145, 180, 199
SinI GGWCC 1 cut(s) 97
SmlI CTYRAG 1 cut(s) 175
SmoI CTYRAG 1 cut(s) 175
Sse9I AATT 5 cut(s) 5, 89, 156, 190, 200
TaaI ACNGT 1 cut(s) 22
TaqI TCGA 1 cut(s) 120
TasI AATT 5 cut(s) 5, 89, 156, 190, 200
Tru1I TTAA 2 cut(s) 176, 217
Tru9I TTAA 2 cut(s) 176, 217
TscAI CASTG 1 cut(s) 27
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 1 cut(s) 27
Vha464I CTTAAG 1 cut(s) 175
VpaK11BI GGWCC 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.