Rh3BG093000

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0029953
Physical Location & Seq
Forward (+)
7347549 .. 7350896
3348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG093000.1

Sequence Viewer

Length: 372 bp
ATGGTGTTTATAGCCCAGATTTGTAGTAGTATTGGGACTTCACATGCACAGGATGATCCAGTTCTATGGCGGACTCTGCTTAGCTCTTGCAATAAGATACATAAAAACGTGGAAATAGGAGAATTTGCCTTGAAGAATCTAATCTGTTTAGGGCCATCGAATGCAGGGGACTACGTACTTCTTGCTACTATTTATTTTAGGGCGAAAGATGCAGATGGTGTTTCAAGGATGAGAAAATTGATTAAAAACCAGGGAGTGAGGACCACTCCTGGTTGGAGCTGGATTGAAGTTGGCGATCATCAGGTTCACAAATTTGTAGCGGATGATAAGTCAATCCAGATACTGAAGAAATCTATCAAAAATTGGAGCTAG

Protein Analysis

123

Amino Acids

13.78

Weight (kDa)

9.27

Isoelectric Point (pI)

29.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
E_motif PF20431 34 - 96 3.3e-15 E motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029953)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0458881
rosa_samantha Rh3BG093000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 70, 320
AclWI GGATC 1 cut(s) 50
AcsI RAATTY 2 cut(s) 122, 311
AcuI CTGAAG 1 cut(s) 365
AfaI GTAC 1 cut(s) 177
AgsI TTSAA 3 cut(s) 133, 225, 287
AjnI CCWGG 2 cut(s) 249, 268
AluBI AGCT 3 cut(s) 84, 279, 369
AluI AGCT 3 cut(s) 84, 279, 369
AlwI GGATC 1 cut(s) 50
AlwNI CAGNNNCTG 1 cut(s) 343
AoxI GGCC 1 cut(s) 152
ApoI RAATTY 2 cut(s) 122, 311
AspS9I GGNCC 2 cut(s) 152, 261
AvaII GGWCC 1 cut(s) 261
BarI GAAGNNNNNNTAC 2 cut(s) 22, 54
BccI CCATC 2 cut(s) 163, 209
BciT130I CCWGG 2 cut(s) 251, 270
BfaI CTAG 1 cut(s) 370
BlpI GCTNAGC 1 cut(s) 80
Bme1390I CCNGG 2 cut(s) 251, 270
Bme18I GGWCC 1 cut(s) 261
BmgT120I GGNCC 2 cut(s) 152, 261
BmrFI CCNGG 2 cut(s) 251, 270
BmsI GCATC 1 cut(s) 199
BplI GAGNNNNNCTC 2 cut(s) 250, 282
Bpu1102I GCTNAGC 1 cut(s) 80
BsaAI YACGTR 1 cut(s) 175
BsaJI CCNNGG 1 cut(s) 250
Bse1I ACTGG 1 cut(s) 59
BseBI CCWGG 2 cut(s) 251, 270
BseDI CCNNGG 1 cut(s) 250
BseGI GGATG 3 cut(s) 58, 234, 328
BseNI ACTGG 1 cut(s) 59
BshFI GGCC 1 cut(s) 154
BslFI GGGAC 2 cut(s) 49, 182
BsmFI GGGAC 2 cut(s) 49, 182
BsmI GAATGC 1 cut(s) 166
BsnI GGCC 1 cut(s) 154
Bsp143I GATC 2 cut(s) 55, 295
Bsp1720I GCTNAGC 1 cut(s) 80
BspACI CCGC 2 cut(s) 70, 320
BspANI GGCC 1 cut(s) 154
BspPI GGATC 1 cut(s) 50
BsrI ACTGG 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 250
BssMI GATC 2 cut(s) 55, 295
Bst2UI CCWGG 2 cut(s) 251, 270
BstBAI YACGTR 1 cut(s) 175
BstDEI CTNAG 1 cut(s) 80
BstF5I GGATG 3 cut(s) 58, 234, 328
BstKTI GATC 2 cut(s) 58, 298
BstMBI GATC 2 cut(s) 55, 295
BstMWI GCNNNNNNNGC 2 cut(s) 76, 209
BstNI CCWGG 2 cut(s) 251, 270
BstNSI RCATGY 1 cut(s) 47
BstSCI CCNGG 2 cut(s) 249, 268
BstSNI TACGTA 1 cut(s) 175
BstXI CCANNNNNNTGG 1 cut(s) 66
BsuRI GGCC 1 cut(s) 154
BtsCI GGATG 3 cut(s) 58, 234, 328
CaiI CAGNNNCTG 1 cut(s) 343
Cfr13I GGNCC 2 cut(s) 152, 261
Csp6I GTAC 1 cut(s) 176
CviAII CATG 1 cut(s) 44
CviJI RGCY 5 cut(s) 14, 84, 154, 279, 369
CviKI_1 RGCY 5 cut(s) 14, 84, 154, 279, 369
CviQI GTAC 1 cut(s) 176
DdeI CTNAG 1 cut(s) 80
DpnI GATC 2 cut(s) 57, 297
DpnII GATC 2 cut(s) 55, 295
EciI GGCGGA 1 cut(s) 85
Eco105I TACGTA 1 cut(s) 175
Eco47I GGWCC 1 cut(s) 261
Eco57I CTGAAG 1 cut(s) 365
EcoRII CCWGG 2 cut(s) 249, 268
FaeI CATG 1 cut(s) 47
FaiI YATR 4 cut(s) 11, 45, 67, 102
FaqI GGGAC 2 cut(s) 49, 182
FatI CATG 1 cut(s) 43
FokI GGATG 3 cut(s) 65, 241, 335
FspBI CTAG 1 cut(s) 370
HaeIII GGCC 1 cut(s) 154
Hin1II CATG 1 cut(s) 47
HinfI GANTC 2 cut(s) 73, 136
Hpy166II GTNNAC 1 cut(s) 307
Hpy188III TCNNGA 1 cut(s) 337
Hpy8I GTNNAC 1 cut(s) 307
HpyCH4IV ACGT 2 cut(s) 108, 174
HpyCH4V TGCA 4 cut(s) 47, 90, 164, 212
HpyF10VI GCNNNNNNNGC 2 cut(s) 76, 209
HpyF3I CTNAG 1 cut(s) 80
HpySE526I ACGT 2 cut(s) 108, 174
Hsp92II CATG 1 cut(s) 47
Kzo9I GATC 2 cut(s) 55, 295
LmnI GCTCC 2 cut(s) 276, 366
LweI GCATC 1 cut(s) 199
MaeI CTAG 1 cut(s) 370
MaeII ACGT 2 cut(s) 108, 174
MalI GATC 2 cut(s) 57, 297
MboI GATC 2 cut(s) 55, 295
MboII GAAGA 2 cut(s) 145, 358
MluCI AATT 4 cut(s) 122, 236, 311, 361
MlyI GAGTC 1 cut(s) 67
MmeI TCCRAC 1 cut(s) 254
MnlI CCTC 1 cut(s) 252
MseI TTAA 1 cut(s) 243
MspR9I CCNGG 2 cut(s) 251, 270
Mva1269I GAATGC 1 cut(s) 166
MvaI CCWGG 2 cut(s) 251, 270
MwoI GCNNNNNNNGC 2 cut(s) 76, 209
NdeII GATC 2 cut(s) 55, 295
NlaIII CATG 1 cut(s) 47
NspI RCATGY 1 cut(s) 47
PctI GAATGC 1 cut(s) 166
PfeI GAWTC 1 cut(s) 136
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
Ppu21I YACGTR 1 cut(s) 175
Psp6I CCWGG 2 cut(s) 249, 268
PspGI CCWGG 2 cut(s) 249, 268
PspPI GGNCC 2 cut(s) 152, 261
PstNI CAGNNNCTG 1 cut(s) 343
RsaI GTAC 1 cut(s) 177
RsaNI GTAC 1 cut(s) 176
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 2 cut(s) 55, 295
Sau96I GGNCC 2 cut(s) 152, 261
SchI GAGTC 1 cut(s) 67
ScrFI CCNGG 2 cut(s) 251, 270
SetI ASST 6 cut(s) 86, 111, 177, 281, 306, 371
SfaNI GCATC 1 cut(s) 199
SinI GGWCC 1 cut(s) 261
SnaBI TACGTA 1 cut(s) 175
Sse9I AATT 4 cut(s) 122, 236, 311, 361
SsiI CCGC 2 cut(s) 70, 320
SspMI CTAG 1 cut(s) 370
StyD4I CCNGG 2 cut(s) 249, 268
TaiI ACGT 2 cut(s) 111, 177
TaqI TCGA 1 cut(s) 158
TasI AATT 4 cut(s) 122, 236, 311, 361
TfiI GAWTC 1 cut(s) 136
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
VpaK11BI GGWCC 1 cut(s) 261
XapI RAATTY 2 cut(s) 122, 311
XceI RCATGY 1 cut(s) 47
XspI CTAG 1 cut(s) 370
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.