Rh3BG180800

Calcium-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
15915527 .. 15919249
3723 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG180800.1

Sequence Viewer

Length: 339 bp
ATGGATGAAAAATTAGCCAAGGAAAAGGCAATTAATGAGTGGCTTCCAATTACTTCTTCGAGGAATGCAACATGGTTATGTGCATGTCTTTGCTGCTATGAGGTTAAAATAAACTTTTCTTTAAAGAAGAATTTTGTGCATGTCTTTGCTGCTATGAGGTTAAAATATATCTGCAACATGATTTCATTTCATGAAATATGTGACCTGAAGTTTTCCTTGATTTTTGTGATTACAGAACATCCATGGTTACAAAACACAAAGAAAGCCCCAAATTTTCCATTAGGAGATATTGCAAAGCCCAGGCTCAAGCAGTTTTCAGTAGTAAGCAGTTCTCAGTAA

Protein Analysis

112

Amino Acids

12.97

Weight (kDa)

9.11

Isoelectric Point (pI)

27.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032509)

Species Orthologous Gene IDs
rosa_samantha Rh3AG156700 Rh3BG180800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 130, 271
AcuI CTGAAG 1 cut(s) 227
AjnI CCWGG 1 cut(s) 299
AjuI GAANNNNNNNTTGG 2 cut(s) 40, 72
ApeKI GCWGC 2 cut(s) 93, 149
ApoI RAATTY 2 cut(s) 130, 271
AseI ATTAAT 1 cut(s) 33
BbvI GCAGC 2 cut(s) 80, 136
BciT130I CCWGG 1 cut(s) 301
BisI GCNGC 2 cut(s) 94, 150
BlsI GCNGC 2 cut(s) 95, 151
Bme1390I CCNGG 1 cut(s) 301
BmrFI CCNGG 1 cut(s) 301
BpuEI CTTGAG 1 cut(s) 290
BsaJI CCNNGG 3 cut(s) 18, 242, 299
BseBI CCWGG 1 cut(s) 301
BseDI CCNNGG 3 cut(s) 18, 242, 299
BseGI GGATG 2 cut(s) 10, 238
BseXI GCAGC 2 cut(s) 80, 136
BsmI GAATGC 1 cut(s) 70
Bsp19I CCATGG 1 cut(s) 242
BspHI TCATGA 1 cut(s) 190
BssECI CCNNGG 3 cut(s) 18, 242, 299
BssT1I CCWWGG 2 cut(s) 18, 242
Bst2UI CCWGG 1 cut(s) 301
BstDEI CTNAG 1 cut(s) 333
BstDSI CCRYGG 1 cut(s) 242
BstF5I GGATG 2 cut(s) 10, 238
BstNI CCWGG 1 cut(s) 301
BstNSI RCATGY 2 cut(s) 87, 143
BstSCI CCNGG 1 cut(s) 299
BstV1I GCAGC 2 cut(s) 80, 136
BtgI CCRYGG 1 cut(s) 242
BtsCI GGATG 2 cut(s) 10, 238
CciI TCATGA 1 cut(s) 190
CviAII CATG 6 cut(s) 72, 84, 140, 178, 191, 243
CviJI RGCY 5 cut(s) 17, 43, 266, 298, 304
CviKI_1 RGCY 5 cut(s) 17, 43, 266, 298, 304
DdeI CTNAG 1 cut(s) 333
DraI TTTAAA 1 cut(s) 123
Eco130I CCWWGG 2 cut(s) 18, 242
Eco57I CTGAAG 1 cut(s) 227
EcoRII CCWGG 1 cut(s) 299
EcoT14I CCWWGG 2 cut(s) 18, 242
ErhI CCWWGG 2 cut(s) 18, 242
FaeI CATG 6 cut(s) 75, 87, 143, 181, 194, 246
FalI AAGNNNNNCTT 2 cut(s) 200, 232
FatI CATG 6 cut(s) 71, 83, 139, 177, 190, 242
Fnu4HI GCNGC 2 cut(s) 94, 150
FokI GGATG 2 cut(s) 17, 225
Fsp4HI GCNGC 2 cut(s) 94, 150
GluI GCNGC 2 cut(s) 94, 150
Hin1II CATG 6 cut(s) 75, 87, 143, 181, 194, 246
Hpy188III TCNNGA 1 cut(s) 191
HpyCH4V TGCA 5 cut(s) 68, 83, 139, 174, 293
HpyF3I CTNAG 1 cut(s) 333
Hsp92II CATG 6 cut(s) 75, 87, 143, 181, 194, 246
LpnPI CCDG 3 cut(s) 218, 286, 313
Lsp1109I GCAGC 2 cut(s) 80, 136
MaeIII GTNAC 2 cut(s) 200, 246
MboII GAAGA 2 cut(s) 48, 139
MluCI AATT 5 cut(s) 11, 30, 48, 130, 271
MnlI CCTC 3 cut(s) 54, 94, 150
MseI TTAA 4 cut(s) 33, 105, 122, 161
MslI CAYNNNNRTG 1 cut(s) 76
MspR9I CCNGG 1 cut(s) 301
Mva1269I GAATGC 1 cut(s) 70
MvaI CCWGG 1 cut(s) 301
NcoI CCATGG 1 cut(s) 242
NlaIII CATG 6 cut(s) 75, 87, 143, 181, 194, 246
NmuCI GTSAC 1 cut(s) 200
NspI RCATGY 2 cut(s) 87, 143
PagI TCATGA 1 cut(s) 190
PctI GAATGC 1 cut(s) 70
PkrI GCNGC 2 cut(s) 95, 151
PshBI ATTAAT 1 cut(s) 33
Psp6I CCWGG 1 cut(s) 299
PspGI CCWGG 1 cut(s) 299
RseI CAYNNNNRTG 1 cut(s) 76
SaqAI TTAA 4 cut(s) 33, 105, 122, 161
SatI GCNGC 2 cut(s) 94, 150
ScrFI CCNGG 1 cut(s) 301
SetI ASST 3 cut(s) 105, 161, 207
SmiMI CAYNNNNRTG 1 cut(s) 76
SmlI CTYRAG 1 cut(s) 305
SmoI CTYRAG 1 cut(s) 305
Sse9I AATT 5 cut(s) 11, 30, 48, 130, 271
StyD4I CCNGG 1 cut(s) 299
StyI CCWWGG 2 cut(s) 18, 242
TaqI TCGA 1 cut(s) 59
TasI AATT 5 cut(s) 11, 30, 48, 130, 271
Tru1I TTAA 4 cut(s) 33, 105, 122, 161
Tru9I TTAA 4 cut(s) 33, 105, 122, 161
TseFI GTSAC 1 cut(s) 200
TseI GCWGC 2 cut(s) 93, 149
Tsp45I GTSAC 1 cut(s) 200
TspDTI ATGAA 4 cut(s) 21, 174, 179, 207
VspI ATTAAT 1 cut(s) 33
XapI RAATTY 2 cut(s) 130, 271
XceI RCATGY 2 cut(s) 87, 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.