Rh3BG216100

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
19559063 .. 19559452
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG216100.1

Sequence Viewer

Length: 390 bp
ATGGAATGGCCCAACATGCAAGTGCCAGAAGTAGAGGTTCTCGTCTTGAATTTTCAGACAAAATCCTATGCATTACCCAAATTTGTGGAGCAAATGAACAACTTGAAAGTTTTAGTAATCGCAAAGGACGATTACCAGAGCGCTGATATAAGTAATTTTGAAGTATTGGGTTCATCATCAGATCTGAAGAGTATAAGATTAGAGGGCATCTCAATTGCTTGCATAACAAGGAAACCCATGCAATTGAATACTCTAAAGAAGATCTCTCTCTACAAGTGTGTCAAGTTTCAGCAACGACATTGTCAAAATGTCCGATGCATTTCCAGTCCTAGAGGAAATGACTATTCAAGAGTGCAAATTTTTGAGAAACTTGCTTCCAGAGCTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.81

Weight (kDa)

9.28

Isoelectric Point (pI)

22.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0033016)

Species Orthologous Gene IDs
rosa_samantha Rh2BG178400 Rh3BG216100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 49, 80, 357
AcuI CTGAAG 1 cut(s) 206
AfeI AGCGCT 1 cut(s) 142
AgsI TTSAA 5 cut(s) 49, 106, 161, 247, 348
AluBI AGCT 1 cut(s) 383
AluI AGCT 1 cut(s) 383
Aor51HI AGCGCT 1 cut(s) 142
AoxI GGCC 1 cut(s) 8
ApoI RAATTY 3 cut(s) 49, 80, 357
AspLEI GCGC 1 cut(s) 143
AspS9I GGNCC 1 cut(s) 9
BfaI CTAG 1 cut(s) 330
BfoI RGCGCY 1 cut(s) 144
BglII AGATCT 2 cut(s) 181, 261
BmgT120I GGNCC 1 cut(s) 9
BmsI GCATC 2 cut(s) 216, 305
BplI GAGNNNNNCTC 2 cut(s) 194, 226
Bse1I ACTGG 1 cut(s) 324
BseNI ACTGG 1 cut(s) 324
BshFI GGCC 1 cut(s) 10
BsnI GGCC 1 cut(s) 10
Bsp143I GATC 2 cut(s) 181, 261
BspANI GGCC 1 cut(s) 10
BsrI ACTGG 1 cut(s) 324
BssMI GATC 2 cut(s) 181, 261
Bst6I CTCTTC 1 cut(s) 182
BstC8I GCNNGC 1 cut(s) 220
BstH2I RGCGCY 1 cut(s) 144
BstHHI GCGC 1 cut(s) 143
BstKTI GATC 2 cut(s) 184, 264
BstMBI GATC 2 cut(s) 181, 261
BstMWI GCNNNNNNNGC 2 cut(s) 16, 380
BstNSI RCATGY 1 cut(s) 19
BstX2I RGATCY 2 cut(s) 181, 261
BstXI CCANNNNNNTGG 1 cut(s) 85
BstYI RGATCY 2 cut(s) 181, 261
BsuRI GGCC 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 220
CfoI GCGC 1 cut(s) 143
Cfr13I GGNCC 1 cut(s) 9
CviAII CATG 2 cut(s) 16, 238
CviJI RGCY 2 cut(s) 10, 383
CviKI_1 RGCY 2 cut(s) 10, 383
DpnI GATC 2 cut(s) 183, 263
DpnII GATC 2 cut(s) 181, 261
Eam1104I CTCTTC 1 cut(s) 182
EarI CTCTTC 1 cut(s) 182
Eco47III AGCGCT 1 cut(s) 142
Eco57I CTGAAG 1 cut(s) 206
EcoT22I ATGCAT 2 cut(s) 73, 320
FaeI CATG 2 cut(s) 19, 241
FaiI YATR 6 cut(s) 17, 69, 149, 194, 224, 239
FatI CATG 2 cut(s) 15, 237
FspBI CTAG 1 cut(s) 330
GlaI GCGC 1 cut(s) 142
HaeII RGCGCY 1 cut(s) 144
HaeIII GGCC 1 cut(s) 10
HhaI GCGC 1 cut(s) 143
Hin1II CATG 2 cut(s) 19, 241
Hin6I GCGC 1 cut(s) 141
HinP1I GCGC 1 cut(s) 141
Hpy188I TCNGA 4 cut(s) 57, 181, 186, 314
Hpy188III TCNNGA 3 cut(s) 46, 348, 378
HpyCH4V TGCA 6 cut(s) 19, 71, 222, 241, 318, 355
HpyF10VI GCNNNNNNNGC 2 cut(s) 16, 380
Hsp92II CATG 2 cut(s) 19, 241
HspAI GCGC 1 cut(s) 141
Kzo9I GATC 2 cut(s) 181, 261
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 3 cut(s) 39, 149, 337
LweI GCATC 2 cut(s) 216, 305
MaeI CTAG 1 cut(s) 330
MalI GATC 2 cut(s) 183, 263
MboI GATC 2 cut(s) 181, 261
MboII GAAGA 2 cut(s) 199, 271
MfeI CAATTG 2 cut(s) 213, 242
MflI RGATCY 2 cut(s) 181, 261
MluCI AATT 6 cut(s) 49, 80, 154, 213, 242, 357
MnlI CCTC 3 cut(s) 28, 196, 326
Mph1103I ATGCAT 2 cut(s) 73, 320
MslI CAYNNNNRTG 1 cut(s) 20
MunI CAATTG 2 cut(s) 213, 242
MwoI GCNNNNNNNGC 2 cut(s) 16, 380
NdeII GATC 2 cut(s) 181, 261
NlaIII CATG 2 cut(s) 19, 241
NsiI ATGCAT 2 cut(s) 73, 320
NspI RCATGY 1 cut(s) 19
PcsI WCGNNNNNNNCGW 1 cut(s) 126
PflFI GACNNNGTC 1 cut(s) 300
PspPI GGNCC 1 cut(s) 9
PsuI RGATCY 2 cut(s) 181, 261
PsyI GACNNNGTC 1 cut(s) 300
RseI CAYNNNNRTG 1 cut(s) 20
Sau3AI GATC 2 cut(s) 181, 261
Sau96I GGNCC 1 cut(s) 9
SetI ASST 2 cut(s) 39, 385
SfaNI GCATC 2 cut(s) 216, 305
SmiMI CAYNNNNRTG 1 cut(s) 20
Sse9I AATT 6 cut(s) 49, 80, 154, 213, 242, 357
SspMI CTAG 1 cut(s) 330
TasI AATT 6 cut(s) 49, 80, 154, 213, 242, 357
TspDTI ATGAA 2 cut(s) 110, 162
Tth111I GACNNNGTC 1 cut(s) 300
XapI RAATTY 3 cut(s) 49, 80, 357
XceI RCATGY 1 cut(s) 19
XspI CTAG 1 cut(s) 330
Zsp2I ATGCAT 2 cut(s) 73, 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.