Rh3BG250200

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked Lys-48-linked is involved in protein degradation via the proteasome

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
23893899 .. 23894075
177 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG250200.1

Sequence Viewer

Length: 177 bp
ATGCAGCCATGCAACATACCCTTGTTTTCAGGATCAGGAAAGCATCCCTCCGGTCAACAGAGATTGATTTTTGTCGGTAAGCAATTGGAAGATTGTAGAACTCTTGCAGATTATAACATCCATAAGGAGTCAACTCTTTCCCTGGTTTTGAGGCTGAGGGGTGGAACCATGATTAAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.58

Weight (kDa)

9.59

Isoelectric Point (pI)

46.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 15 - 50 9.9e-06 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 16 - 53 9.7e-12 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029981)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0478251
rosa_samantha Rh3BG250200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 114
AclWI GGATC 1 cut(s) 40
AjnI CCWGG 1 cut(s) 141
AlwI GGATC 1 cut(s) 40
ApeKI GCWGC 1 cut(s) 4
BbvCI CCTCAGC 1 cut(s) 155
BbvI GCAGC 1 cut(s) 16
BciT130I CCWGG 1 cut(s) 143
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 143
BmiI GGNNCC 1 cut(s) 166
BmrFI CCNGG 1 cut(s) 143
BmsI GCATC 1 cut(s) 52
Bpu10I CCTNAGC 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 141
BsaWI WCCGGW 1 cut(s) 50
BseBI CCWGG 1 cut(s) 143
BseDI CCNNGG 1 cut(s) 141
BseGI GGATG 2 cut(s) 43, 117
BseMII CTCAG 1 cut(s) 146
BseXI GCAGC 1 cut(s) 16
BsiSI CCGG 1 cut(s) 51
Bsp143I GATC 1 cut(s) 32
BspCNI CTCAG 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 166
BspPI GGATC 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 143
BstDEI CTNAG 1 cut(s) 155
BstF5I GGATG 2 cut(s) 43, 117
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstNI CCWGG 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 141
BstV1I GCAGC 1 cut(s) 16
BtsCI GGATG 2 cut(s) 43, 117
CviAII CATG 2 cut(s) 9, 169
CviJI RGCY 2 cut(s) 7, 154
CviKI_1 RGCY 2 cut(s) 7, 154
DdeI CTNAG 1 cut(s) 155
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
EcoRII CCWGG 1 cut(s) 141
FaeI CATG 2 cut(s) 12, 172
FaiI YATR 5 cut(s) 10, 17, 114, 123, 170
FatI CATG 2 cut(s) 8, 168
Fnu4HI GCNGC 1 cut(s) 5
FokI GGATG 2 cut(s) 30, 104
Fsp4HI GCNGC 1 cut(s) 5
GluI GCNGC 1 cut(s) 5
HapII CCGG 1 cut(s) 51
Hin1II CATG 2 cut(s) 12, 172
HincII GTYRAC 2 cut(s) 56, 132
HindII GTYRAC 2 cut(s) 56, 132
HinfI GANTC 1 cut(s) 128
HpaII CCGG 1 cut(s) 51
Hpy166II GTNNAC 2 cut(s) 56, 132
Hpy188III TCNNGA 2 cut(s) 30, 36
Hpy8I GTNNAC 2 cut(s) 56, 132
HpyCH4V TGCA 3 cut(s) 4, 12, 107
HpyF3I CTNAG 1 cut(s) 155
Hsp92II CATG 2 cut(s) 12, 172
Kzo9I GATC 1 cut(s) 32
LpnPI CCDG 5 cut(s) 15, 21, 64, 128, 155
Lsp1109I GCAGC 1 cut(s) 16
LweI GCATC 1 cut(s) 52
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 1 cut(s) 101
MfeI CAATTG 1 cut(s) 83
MluCI AATT 1 cut(s) 83
MlyI GAGTC 1 cut(s) 137
MnlI CCTC 3 cut(s) 58, 144, 150
MseI TTAA 1 cut(s) 174
MspI CCGG 1 cut(s) 51
MspR9I CCNGG 1 cut(s) 143
MunI CAATTG 1 cut(s) 83
MvaI CCWGG 1 cut(s) 143
NdeII GATC 1 cut(s) 32
NlaIII CATG 2 cut(s) 12, 172
NlaIV GGNNCC 1 cut(s) 166
PkrI GCNGC 1 cut(s) 6
PleI GAGTC 1 cut(s) 136
PpsI GAGTC 1 cut(s) 136
PsiI TTATAA 1 cut(s) 114
Psp6I CCWGG 1 cut(s) 141
PspGI CCWGG 1 cut(s) 141
PspN4I GGNNCC 1 cut(s) 166
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 1 cut(s) 32
SchI GAGTC 1 cut(s) 137
ScrFI CCNGG 1 cut(s) 143
SfaNI GCATC 1 cut(s) 52
SgeI CNNG 8 cut(s) 21, 34, 42, 48, 63, 116, 154, 155
Sse9I AATT 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 141
TasI AATT 1 cut(s) 83
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseI GCWGC 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.