Rh3CG371300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
47603877 .. 47609575
5699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG371300.1

Sequence Viewer

Length: 195 bp
ATGGTGGGCAGGTATGGGTTTGTGGAGGCTAGGAGAAAAGTTGGATTTGAGGGAGGCGGTGATTTTGGTAGCCGGAGATCGAAGAAGAAAAAGAAGATTGGGTCGAAGATTGGTCAATTTTTGTCATGGCCATTATATGCTCAACCAAATTTCTGGGTATTTAAATCTGTAGTGAATGTCCTTGATGAGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.3

Weight (kDa)

10.35

Isoelectric Point (pI)

33.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029939)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0497511
rosa_samantha Rh3CG371300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 57
AcoI YGGCCR 1 cut(s) 128
AcsI RAATTY 1 cut(s) 148
AoxI GGCC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 148
AsuHPI GGTGA 1 cut(s) 71
BalI TGGCCA 1 cut(s) 130
BfaI CTAG 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 168
BshFI GGCC 1 cut(s) 130
BsiSI CCGG 1 cut(s) 73
BsnI GGCC 1 cut(s) 130
Bsp143I GATC 1 cut(s) 77
BspACI CCGC 1 cut(s) 57
BspANI GGCC 1 cut(s) 130
BssMI GATC 1 cut(s) 77
BstKTI GATC 1 cut(s) 80
BstMBI GATC 1 cut(s) 77
BstSFI CTRYAG 1 cut(s) 168
BstXI CCANNNNNNTGG 1 cut(s) 153
BsuRI GGCC 1 cut(s) 130
CviAII CATG 1 cut(s) 126
CviJI RGCY 3 cut(s) 29, 72, 130
CviKI_1 RGCY 3 cut(s) 29, 72, 130
DpnI GATC 1 cut(s) 79
DpnII GATC 1 cut(s) 77
DraI TTTAAA 1 cut(s) 163
EaeI YGGCCR 1 cut(s) 128
FaeI CATG 1 cut(s) 129
FaiI YATR 5 cut(s) 15, 127, 136, 138, 193
FatI CATG 1 cut(s) 125
FspBI CTAG 1 cut(s) 30
HaeIII GGCC 1 cut(s) 130
HapII CCGG 1 cut(s) 73
Hin1II CATG 1 cut(s) 129
HpaII CCGG 1 cut(s) 73
HphI GGTGA 1 cut(s) 71
Hsp92II CATG 1 cut(s) 129
Kzo9I GATC 1 cut(s) 77
LpnPI CCDG 2 cut(s) 86, 139
MaeI CTAG 1 cut(s) 30
MalI GATC 1 cut(s) 79
MboI GATC 1 cut(s) 77
MboII GAAGA 4 cut(s) 94, 97, 106, 118
MlsI TGGCCA 1 cut(s) 130
MluCI AATT 2 cut(s) 116, 148
MluNI TGGCCA 1 cut(s) 130
MmeI TCCRAC 1 cut(s) 22
MnlI CCTC 3 cut(s) 19, 43, 47
Mox20I TGGCCA 1 cut(s) 130
MscI TGGCCA 1 cut(s) 130
MseI TTAA 1 cut(s) 162
Msp20I TGGCCA 1 cut(s) 130
MspI CCGG 1 cut(s) 73
NdeII GATC 1 cut(s) 77
NlaIII CATG 1 cut(s) 129
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 1 cut(s) 77
SetI ASST 1 cut(s) 14
SfcI CTRYAG 1 cut(s) 168
SgeI CNNG 5 cut(s) 22, 42, 85, 138, 166
SmiI ATTTAAAT 1 cut(s) 163
Sse9I AATT 2 cut(s) 116, 148
SsiI CCGC 1 cut(s) 57
SspMI CTAG 1 cut(s) 30
SwaI ATTTAAAT 1 cut(s) 163
TaqI TCGA 2 cut(s) 80, 104
TasI AATT 2 cut(s) 116, 148
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
XapI RAATTY 1 cut(s) 148
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.