Rh3DG218200

GMC oxidoreductase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
20263119 .. 20264418
1300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG218200.1

Sequence Viewer

Length: 489 bp
ATGCCAAAACTTCTACAGATAAAAATTATATACTTTCAGCAATCCAGGGAGGATGCACTGTTAAAACAGAATGTGAAGTATGTAGTGAGGGACATGTATGAAAATTTCCCATGTAAGGGCAACATTGGCAGAAAAAATAGAAGATGGCGTGTCTACTTTAATGAGATTGACTATATAACCTCTGATTTTGTAATCCTATCAGCTGGAGTTTTTGGGACAACTGAGATACTCTTCCAATCACAGATGAGAGGACTGAAACTTTCAGAAGCACTTGGGTCTGGATTCAGCTGTAATGGGAATACTGTGGCTTATCTTGCTGGAAGTCCAGCACCATTGGGTGCTTATGGATTAGACAGAAAGCAATTGTTTAAGACTCCTTTTGAGGAAAGGCCAGGGCCATCCATCTCTTCAGCTTACATGCACCTCTTCACTGGGATTTACAATCCAGAGTGCCGTACTTCCGACAGCTTATCCATACCTGCTGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

162

Amino Acids

18.28

Weight (kDa)

9.15

Isoelectric Point (pI)

59.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029995)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0474631
rosa_samantha Rh3DG218200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 153
AcsI RAATTY 1 cut(s) 103
AcuI CTGAAG 1 cut(s) 393
AfaI GTAC 1 cut(s) 457
AfiI CCNNNNNNNGG 2 cut(s) 115, 116
AflIII ACRYGT 1 cut(s) 93
AjnI CCWGG 2 cut(s) 44, 391
AluBI AGCT 4 cut(s) 203, 288, 413, 468
AluI AGCT 4 cut(s) 203, 288, 413, 468
AoxI GGCC 2 cut(s) 389, 395
ApoI RAATTY 1 cut(s) 103
AspS9I GGNCC 1 cut(s) 395
BccI CCATC 3 cut(s) 138, 406, 410
BceAI ACGGC 1 cut(s) 438
BciT130I CCWGG 2 cut(s) 46, 393
BfmI CTRYAG 1 cut(s) 14
Bme1390I CCNGG 2 cut(s) 46, 393
BmgT120I GGNCC 1 cut(s) 395
BmrFI CCNGG 2 cut(s) 46, 393
BmrI ACTGGG 1 cut(s) 441
BmsI GCATC 1 cut(s) 43
BmuI ACTGGG 1 cut(s) 441
BpmI CTGGAG 1 cut(s) 225
BsaJI CCNNGG 2 cut(s) 45, 392
Bsc4I CCNNNNNNNGG 2 cut(s) 115, 116
Bse1I ACTGG 1 cut(s) 436
BseBI CCWGG 2 cut(s) 46, 393
BseDI CCNNGG 2 cut(s) 45, 392
BseGI GGATG 2 cut(s) 58, 398
BseLI CCNNNNNNNGG 2 cut(s) 115, 116
BseMII CTCAG 1 cut(s) 213
BseNI ACTGG 1 cut(s) 436
BshFI GGCC 2 cut(s) 391, 397
BslFI GGGAC 2 cut(s) 104, 229
BslI CCNNNNNNNGG 2 cut(s) 115, 116
BsmFI GGGAC 2 cut(s) 104, 229
BsnI GGCC 2 cut(s) 391, 397
BspANI GGCC 2 cut(s) 391, 397
BspCNI CTCAG 1 cut(s) 214
BsrI ACTGG 1 cut(s) 436
BssECI CCNNGG 2 cut(s) 45, 392
Bst2UI CCWGG 2 cut(s) 46, 393
Bst4CI ACNGT 2 cut(s) 60, 304
Bst6I CTCTTC 3 cut(s) 236, 412, 431
BstDEI CTNAG 1 cut(s) 222
BstF5I GGATG 2 cut(s) 58, 398
BstMWI GCNNNNNNNGC 2 cut(s) 126, 314
BstNI CCWGG 2 cut(s) 46, 393
BstNSI RCATGY 2 cut(s) 97, 421
BstSCI CCNGG 2 cut(s) 44, 391
BstSFI CTRYAG 1 cut(s) 14
BsuRI GGCC 2 cut(s) 391, 397
BtsCI GGATG 2 cut(s) 58, 398
BtsIMutI CAGTG 2 cut(s) 56, 429
Cfr13I GGNCC 1 cut(s) 395
Csp6I GTAC 1 cut(s) 456
CviAII CATG 3 cut(s) 94, 111, 418
CviJI RGCY 7 cut(s) 203, 288, 308, 391, 397, 413, 468
CviKI_1 RGCY 7 cut(s) 203, 288, 308, 391, 397, 413, 468
CviQI GTAC 1 cut(s) 456
DdeI CTNAG 1 cut(s) 222
Eam1104I CTCTTC 3 cut(s) 236, 412, 431
EarI CTCTTC 3 cut(s) 236, 412, 431
Eco57I CTGAAG 1 cut(s) 393
EcoRII CCWGG 2 cut(s) 44, 391
FaeI CATG 3 cut(s) 97, 114, 421
FaqI GGGAC 2 cut(s) 104, 229
FatI CATG 3 cut(s) 93, 110, 417
FblI GTMKAC 1 cut(s) 153
FokI GGATG 2 cut(s) 65, 385
GsuI CTGGAG 1 cut(s) 225
HaeIII GGCC 2 cut(s) 391, 397
Hin1II CATG 3 cut(s) 97, 114, 421
HinfI GANTC 2 cut(s) 282, 373
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 3 cut(s) 184, 265, 463
Hpy188III TCNNGA 2 cut(s) 279, 446
Hpy8I GTNNAC 1 cut(s) 154
HpyCH4III ACNGT 2 cut(s) 60, 304
HpyCH4V TGCA 2 cut(s) 56, 421
HpyF10VI GCNNNNNNNGC 2 cut(s) 126, 314
HpyF3I CTNAG 1 cut(s) 222
Hsp92II CATG 3 cut(s) 97, 114, 421
LweI GCATC 1 cut(s) 43
MboII GAAGA 4 cut(s) 153, 223, 399, 418
MfeI CAATTG 1 cut(s) 362
MluCI AATT 3 cut(s) 24, 103, 362
MlyI GAGTC 1 cut(s) 367
MmeI TCCRAC 1 cut(s) 486
MnlI CCTC 6 cut(s) 43, 81, 190, 242, 376, 434
MseI TTAA 4 cut(s) 62, 159, 369, 487
MspA1I CMGCKG 2 cut(s) 203, 288
MspR9I CCNGG 2 cut(s) 46, 393
MunI CAATTG 1 cut(s) 362
MvaI CCWGG 2 cut(s) 46, 393
MwoI GCNNNNNNNGC 2 cut(s) 126, 314
NlaIII CATG 3 cut(s) 97, 114, 421
NspI RCATGY 2 cut(s) 97, 421
PciI ACATGT 1 cut(s) 93
PfeI GAWTC 1 cut(s) 282
PleI GAGTC 1 cut(s) 367
PpsI GAGTC 1 cut(s) 367
PscI ACATGT 1 cut(s) 93
Psp6I CCWGG 2 cut(s) 44, 391
PspGI CCWGG 2 cut(s) 44, 391
PspPI GGNCC 1 cut(s) 395
PvuII CAGCTG 2 cut(s) 203, 288
RsaI GTAC 1 cut(s) 457
RsaNI GTAC 1 cut(s) 456
SaqAI TTAA 4 cut(s) 62, 159, 369, 487
Sau96I GGNCC 1 cut(s) 395
SchI GAGTC 1 cut(s) 367
ScrFI CCNGG 2 cut(s) 46, 393
SetI ASST 7 cut(s) 182, 205, 290, 415, 426, 470, 481
SfaNI GCATC 1 cut(s) 43
SfcI CTRYAG 1 cut(s) 14
Sse9I AATT 3 cut(s) 24, 103, 362
StyD4I CCNGG 2 cut(s) 44, 391
TaaI ACNGT 2 cut(s) 60, 304
TasI AATT 3 cut(s) 24, 103, 362
TfiI GAWTC 1 cut(s) 282
Tru1I TTAA 4 cut(s) 62, 159, 369, 487
Tru9I TTAA 4 cut(s) 62, 159, 369, 487
TscAI CASTG 2 cut(s) 63, 436
TspDTI ATGAA 1 cut(s) 114
TspRI CASTG 2 cut(s) 63, 436
XapI RAATTY 1 cut(s) 103
XceI RCATGY 2 cut(s) 97, 421
XmiI GTMKAC 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.