Rh4AG188600

Small ubiquitin-related modifier

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
46789779 .. 46791834
2056 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG188600.1

Sequence Viewer

Length: 351 bp
ATGGCTGGAAATGCTCCTCAAGGAAGTTCTTCTGAACCAGAATCAGGGGTTACTTCTCAGGCAGGTCAAGAAAAGAAGCCCAACATTAATGATAATACTGAGTTTGTCAATCTCCAGATTTATTATGAGCAAGATGGAAGTGAAACCAAATTCAGGGTTAGAAGAAATACCAAGCTACAGAAACTTCTGGTTCAATTCTGTACACATCGTTCCCTGGATATGAAAGCCCTGGCATTCTTGTTTGAAGGAACAGAACTTAAACTGGAGCAAACTCCGCAGGAGCTTCAAATGGAAGATGGTGATGTGATTGATGTCATGATCCATGCCTCTGGGGGTTCAAGGATGGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

12.97

Weight (kDa)

4.98

Isoelectric Point (pI)

63.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 44 - 107 1e-18 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 44 - 109 4e-09 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017285)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 53
AciI CCGC 1 cut(s) 275
AclWI GGATC 1 cut(s) 313
AcsI RAATTY 1 cut(s) 149
AfaI GTAC 1 cut(s) 202
AfiI CCNNNNNNNGG 2 cut(s) 44, 153
AgsI TTSAA 4 cut(s) 194, 245, 287, 339
AjnI CCWGG 2 cut(s) 213, 228
AluBI AGCT 2 cut(s) 175, 283
AluI AGCT 2 cut(s) 175, 283
AlwI GGATC 1 cut(s) 313
ApoI RAATTY 1 cut(s) 149
AseI ATTAAT 1 cut(s) 87
Asp700I GAANNNNTTC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 311
BccI CCATC 3 cut(s) 128, 290, 337
BciT130I CCWGG 2 cut(s) 215, 230
BfmI CTRYAG 1 cut(s) 176
BfuAI ACCTGC 1 cut(s) 53
Bme1390I CCNGG 2 cut(s) 215, 230
BmrFI CCNGG 2 cut(s) 215, 230
BpmI CTGGAG 2 cut(s) 98, 284
BsaJI CCNNGG 2 cut(s) 213, 228
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 153
Bse1I ACTGG 1 cut(s) 267
BseBI CCWGG 2 cut(s) 215, 230
BseDI CCNNGG 2 cut(s) 213, 228
BseGI GGATG 1 cut(s) 348
BseLI CCNNNNNNNGG 2 cut(s) 44, 153
BseMII CTCAG 2 cut(s) 71, 90
BseNI ACTGG 1 cut(s) 267
BseRI GAGGAG 1 cut(s) 6
BslI CCNNNNNNNGG 2 cut(s) 44, 153
BsmI GAATGC 1 cut(s) 233
Bsp1407I TGTACA 1 cut(s) 200
Bsp143I GATC 1 cut(s) 318
BspACI CCGC 1 cut(s) 275
BspCNI CTCAG 2 cut(s) 70, 91
BspHI TCATGA 1 cut(s) 315
BspMI ACCTGC 1 cut(s) 53
BspPI GGATC 1 cut(s) 313
BsrGI TGTACA 1 cut(s) 200
BsrI ACTGG 1 cut(s) 267
BssECI CCNNGG 2 cut(s) 213, 228
BssMI GATC 1 cut(s) 318
Bst2UI CCWGG 2 cut(s) 215, 230
BstAUI TGTACA 1 cut(s) 200
BstDEI CTNAG 2 cut(s) 57, 99
BstF5I GGATG 1 cut(s) 348
BstKTI GATC 1 cut(s) 321
BstMBI GATC 1 cut(s) 318
BstMWI GCNNNNNNNGC 2 cut(s) 11, 274
BstNI CCWGG 2 cut(s) 215, 230
BstSCI CCNGG 2 cut(s) 213, 228
BstSFI CTRYAG 1 cut(s) 176
BstXI CCANNNNNNTGG 1 cut(s) 329
BtsCI GGATG 1 cut(s) 348
BveI ACCTGC 1 cut(s) 53
CciI TCATGA 1 cut(s) 315
Csp6I GTAC 1 cut(s) 201
CviAII CATG 2 cut(s) 316, 323
CviJI RGCY 5 cut(s) 5, 79, 175, 227, 283
CviKI_1 RGCY 5 cut(s) 5, 79, 175, 227, 283
CviQI GTAC 1 cut(s) 201
DdeI CTNAG 2 cut(s) 57, 99
DpnI GATC 1 cut(s) 320
DpnII GATC 1 cut(s) 318
EcoRII CCWGG 2 cut(s) 213, 228
FaeI CATG 2 cut(s) 319, 326
FaiI YATR 4 cut(s) 126, 221, 317, 324
FatI CATG 2 cut(s) 315, 322
GsuI CTGGAG 2 cut(s) 98, 284
Hin1II CATG 2 cut(s) 319, 326
HinfI GANTC 1 cut(s) 41
HphI GGTGA 1 cut(s) 311
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 3 cut(s) 68, 115, 316
Hpy8I GTNNAC 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 239
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 274
HpyF3I CTNAG 2 cut(s) 57, 99
Hsp92II CATG 2 cut(s) 319, 326
Kzo9I GATC 1 cut(s) 318
LmnI GCTCC 3 cut(s) 19, 265, 280
MaeIII GTNAC 1 cut(s) 49
MalI GATC 1 cut(s) 320
MboI GATC 1 cut(s) 318
MboII GAAGA 3 cut(s) 21, 174, 305
MluCI AATT 2 cut(s) 149, 194
MnlI CCTC 2 cut(s) 27, 337
MroXI GAANNNNTTC 1 cut(s) 28
MseI TTAA 2 cut(s) 87, 258
MspR9I CCNGG 2 cut(s) 215, 230
Mva1269I GAATGC 1 cut(s) 233
MvaI CCWGG 2 cut(s) 215, 230
MwoI GCNNNNNNNGC 2 cut(s) 11, 274
NdeII GATC 1 cut(s) 318
NlaIII CATG 2 cut(s) 319, 326
PagI TCATGA 1 cut(s) 315
PctI GAATGC 1 cut(s) 233
PdmI GAANNNNTTC 1 cut(s) 28
PfeI GAWTC 1 cut(s) 41
PshBI ATTAAT 1 cut(s) 87
Psp6I CCWGG 2 cut(s) 213, 228
PspGI CCWGG 2 cut(s) 213, 228
PsrI GAACNNNNNNTAC 2 cut(s) 193, 225
RsaI GTAC 1 cut(s) 202
RsaNI GTAC 1 cut(s) 201
SaqAI TTAA 2 cut(s) 87, 258
Sau3AI GATC 1 cut(s) 318
ScrFI CCNGG 2 cut(s) 215, 230
SetI ASST 3 cut(s) 67, 177, 285
SfcI CTRYAG 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 18
SmoI CTYRAG 1 cut(s) 18
Sse9I AATT 2 cut(s) 149, 194
SsiI CCGC 1 cut(s) 275
StyD4I CCNGG 2 cut(s) 213, 228
TasI AATT 2 cut(s) 149, 194
TatI WGTACW 1 cut(s) 200
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 2 cut(s) 87, 258
Tru9I TTAA 2 cut(s) 87, 258
TspDTI ATGAA 1 cut(s) 236
VspI ATTAAT 1 cut(s) 87
XapI RAATTY 1 cut(s) 149
XmnI GAANNNNTTC 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.