Rh4AG221900

Vesicle-fusing

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
52097970 .. 52098438
469 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG221900.1

Sequence Viewer

Length: 216 bp
ATGATCTCAAGTGAAACATACTTCATTTTTGAGGCACCGAGTGGAAATGGAATAGAGTTTGTGAACCAAGGTTCTGATACGACTAGCAATATCTTTAAGCACAAGGAATTCAACCTTCAAACACTTGGCATTGGTGGCATAGGTGCTGAGTTTGCAGATATATTTCAAAGAGCTTTCGCCTCCTGTGTCTTCCCTGCGCATGTTACAAATAAGTAA

Protein Analysis

71

Amino Acids

7.75

Weight (kDa)

5.05

Isoelectric Point (pI)

35.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022722)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0419841
rosa_roxburghii Rroxscaffold_5G00362600
rosa_samantha Rh4AG221900 Rh4BG224000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 198
AccB1I GGYRCC 1 cut(s) 34
AcsI RAATTY 1 cut(s) 107
AdeI CACNNNGTG 1 cut(s) 41
AgsI TTSAA 3 cut(s) 112, 119, 167
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
ApoI RAATTY 1 cut(s) 107
AspLEI GCGC 1 cut(s) 199
BanI GGYRCC 1 cut(s) 34
BbsI GAAGAC 1 cut(s) 181
BfaI CTAG 1 cut(s) 84
BmiI GGNNCC 1 cut(s) 36
BpiI GAAGAC 1 cut(s) 181
BsaJI CCNNGG 1 cut(s) 67
BseDI CCNNGG 1 cut(s) 67
BseMII CTCAG 1 cut(s) 138
BshNI GGYRCC 1 cut(s) 34
Bsp143I GATC 1 cut(s) 3
BspCNI CTCAG 1 cut(s) 139
BspLI GGNNCC 1 cut(s) 36
BspT107I GGYRCC 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 67
BssMI GATC 1 cut(s) 3
BssT1I CCWWGG 1 cut(s) 67
BstDEI CTNAG 1 cut(s) 147
BstHHI GCGC 1 cut(s) 199
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 2 cut(s) 135, 152
BstNSI RCATGY 1 cut(s) 203
BstV2I GAAGAC 1 cut(s) 181
CfoI GCGC 1 cut(s) 199
CviAII CATG 1 cut(s) 200
CviJI RGCY 1 cut(s) 173
CviKI_1 RGCY 1 cut(s) 173
DdeI CTNAG 1 cut(s) 147
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
DraIII CACNNNGTG 1 cut(s) 41
Eco130I CCWWGG 1 cut(s) 67
EcoRI GAATTC 1 cut(s) 107
EcoT14I CCWWGG 1 cut(s) 67
ErhI CCWWGG 1 cut(s) 67
FaeI CATG 1 cut(s) 203
FaiI YATR 4 cut(s) 19, 140, 161, 201
FatI CATG 1 cut(s) 199
FspBI CTAG 1 cut(s) 84
FspI TGCGCA 1 cut(s) 198
GlaI GCGC 1 cut(s) 198
HhaI GCGC 1 cut(s) 199
Hin1II CATG 1 cut(s) 203
Hin6I GCGC 1 cut(s) 197
HinP1I GCGC 1 cut(s) 197
Hpy166II GTNNAC 1 cut(s) 64
Hpy188I TCNGA 1 cut(s) 76
Hpy8I GTNNAC 1 cut(s) 64
HpyAV CCTTC 1 cut(s) 125
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 2 cut(s) 135, 152
HpyF3I CTNAG 1 cut(s) 147
Hsp92II CATG 1 cut(s) 203
HspAI GCGC 1 cut(s) 197
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 2 cut(s) 196, 207
MaeI CTAG 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 202
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 181
MluCI AATT 1 cut(s) 107
MnlI CCTC 2 cut(s) 25, 190
MseI TTAA 1 cut(s) 96
MwoI GCNNNNNNNGC 2 cut(s) 135, 152
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 203
NlaIV GGNNCC 1 cut(s) 36
NsbI TGCGCA 1 cut(s) 198
NspI RCATGY 1 cut(s) 203
PspN4I GGNNCC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 96
Sau3AI GATC 1 cut(s) 3
SetI ASST 4 cut(s) 73, 117, 145, 175
SgeI CNNG 9 cut(s) 21, 51, 80, 96, 115, 137, 195, 206, 212
SmlI CTYRAG 1 cut(s) 7
SmoI CTYRAG 1 cut(s) 7
Sse9I AATT 1 cut(s) 107
SspMI CTAG 1 cut(s) 84
StyI CCWWGG 1 cut(s) 67
TasI AATT 1 cut(s) 107
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TspDTI ATGAA 1 cut(s) 13
XapI RAATTY 1 cut(s) 107
XceI RCATGY 1 cut(s) 203
XspI CTAG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.