Rh4CG075600

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0025155
Physical Location & Seq
Reverse (-)
13822087 .. 13822359
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG075600.1

Sequence Viewer

Length: 273 bp
ATGGAACTTGACCCAGGGCACTCTGGTAATTATGTGTTAACATCCAATATTTTCATAGATACTGATCATTATGAAGAGGTATCAGAAGTTAGACGTACAATGAGGCAACCGAATATCAAGAAGGCACCAGGCTGTAGCTGGACTGAGTTGAAGGACGATGTGCATGCTTTTATCAATGGTGATTGGGTCCATCCTAAAACCAACATTATTTATGCTGAATTGGACTCCTTGACAGCTCGACTTCGTGAGCATGGATATGTGCCCCAGCTCTAG

Protein Analysis

90

Amino Acids

10.38

Weight (kDa)

5.39

Isoelectric Point (pI)

45.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
E_motif PF20431 1 - 49 4.2e-15 E motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025155)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0219911
rosa_samantha Rh4BG067700 Rh4CG075600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 124
AfaI GTAC 1 cut(s) 97
AgsI TTSAA 1 cut(s) 151
AjnI CCWGG 2 cut(s) 13, 127
AluBI AGCT 3 cut(s) 138, 236, 268
AluI AGCT 3 cut(s) 138, 236, 268
AspS9I GGNCC 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 191
AvaII GGWCC 1 cut(s) 187
BaeGI GKGCMC 2 cut(s) 21, 264
BanI GGYRCC 1 cut(s) 124
BccI CCATC 1 cut(s) 198
BcgI CGANNNNNNTGC 2 cut(s) 146, 180
BciT130I CCWGG 2 cut(s) 15, 129
BclI TGATCA 1 cut(s) 64
BfaI CTAG 1 cut(s) 271
BfmI CTRYAG 1 cut(s) 133
Bme1390I CCNGG 2 cut(s) 15, 129
Bme18I GGWCC 1 cut(s) 187
BmgT120I GGNCC 1 cut(s) 187
BmiI GGNNCC 2 cut(s) 126, 188
BmrFI CCNGG 2 cut(s) 15, 129
BsaBI GATNNNNATC 1 cut(s) 63
BsaJI CCNNGG 2 cut(s) 13, 14
Bse8I GATNNNNATC 1 cut(s) 63
BseBI CCWGG 2 cut(s) 15, 129
BseDI CCNNGG 2 cut(s) 13, 14
BseGI GGATG 2 cut(s) 41, 190
BseJI GATNNNNATC 1 cut(s) 63
BseMII CTCAG 1 cut(s) 135
BseSI GKGCMC 2 cut(s) 21, 264
BseYI CCCAGC 1 cut(s) 264
BshNI GGYRCC 1 cut(s) 124
Bsp1286I GDGCHC 2 cut(s) 21, 264
Bsp143I GATC 1 cut(s) 64
BspCNI CTCAG 1 cut(s) 136
BspLI GGNNCC 2 cut(s) 126, 188
BspT107I GGYRCC 1 cut(s) 124
BssECI CCNNGG 2 cut(s) 13, 14
BssMI GATC 1 cut(s) 64
Bst2UI CCWGG 2 cut(s) 15, 129
Bst6I CTCTTC 1 cut(s) 69
BstC8I GCNNGC 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 144
BstF5I GGATG 2 cut(s) 41, 190
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstNI CCWGG 2 cut(s) 15, 129
BstNSI RCATGY 1 cut(s) 167
BstSCI CCNGG 2 cut(s) 13, 127
BstSFI CTRYAG 1 cut(s) 133
BstSLI GKGCMC 2 cut(s) 21, 264
BtsCI GGATG 2 cut(s) 41, 190
Cac8I GCNNGC 1 cut(s) 165
Cfr13I GGNCC 1 cut(s) 187
Csp6I GTAC 1 cut(s) 96
CviAII CATG 2 cut(s) 164, 251
CviJI RGCY 4 cut(s) 132, 138, 236, 268
CviKI_1 RGCY 4 cut(s) 132, 138, 236, 268
CviQI GTAC 1 cut(s) 96
DdeI CTNAG 1 cut(s) 144
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
Eam1104I CTCTTC 1 cut(s) 69
EarI CTCTTC 1 cut(s) 69
Eco47I GGWCC 1 cut(s) 187
EcoRII CCWGG 2 cut(s) 13, 127
FaeI CATG 2 cut(s) 167, 254
FaiI YATR 7 cut(s) 33, 56, 72, 165, 213, 252, 258
FatI CATG 2 cut(s) 163, 250
FbaI TGATCA 1 cut(s) 64
FokI GGATG 2 cut(s) 28, 177
FspBI CTAG 1 cut(s) 271
GsaI CCCAGC 1 cut(s) 268
Hin1II CATG 2 cut(s) 167, 254
HincII GTYRAC 1 cut(s) 39
HindII GTYRAC 1 cut(s) 39
HinfI GANTC 1 cut(s) 224
HpaI GTTAAC 1 cut(s) 39
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 39
Hpy188I TCNGA 1 cut(s) 85
Hpy188III TCNNGA 2 cut(s) 118, 245
Hpy8I GTNNAC 1 cut(s) 39
HpyAV CCTTC 2 cut(s) 115, 145
HpyCH4IV ACGT 1 cut(s) 94
HpyCH4V TGCA 1 cut(s) 163
HpyF3I CTNAG 1 cut(s) 144
HpySE526I ACGT 1 cut(s) 94
Hsp92II CATG 2 cut(s) 167, 254
Ksp22I TGATCA 1 cut(s) 64
KspAI GTTAAC 1 cut(s) 39
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 5 cut(s) 9, 27, 114, 124, 141
MaeI CTAG 1 cut(s) 271
MaeII ACGT 1 cut(s) 94
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 1 cut(s) 86
MhlI GDGCHC 2 cut(s) 21, 264
MluCI AATT 2 cut(s) 28, 218
MlyI GAGTC 1 cut(s) 218
MnlI CCTC 2 cut(s) 70, 96
MseI TTAA 1 cut(s) 38
MslI CAYNNNNRTG 1 cut(s) 255
MspR9I CCNGG 2 cut(s) 15, 129
MvaI CCWGG 2 cut(s) 15, 129
NdeII GATC 1 cut(s) 64
NlaIII CATG 2 cut(s) 167, 254
NlaIV GGNNCC 2 cut(s) 126, 188
NspI RCATGY 1 cut(s) 167
PaeI GCATGC 1 cut(s) 167
PasI CCCWGGG 1 cut(s) 14
PleI GAGTC 1 cut(s) 218
PpsI GAGTC 1 cut(s) 218
Psp6I CCWGG 2 cut(s) 13, 127
PspFI CCCAGC 1 cut(s) 264
PspGI CCWGG 2 cut(s) 13, 127
PspN4I GGNNCC 2 cut(s) 126, 188
PspPI GGNCC 1 cut(s) 187
RsaI GTAC 1 cut(s) 97
RsaNI GTAC 1 cut(s) 96
RseI CAYNNNNRTG 1 cut(s) 255
SaqAI TTAA 1 cut(s) 38
Sau3AI GATC 1 cut(s) 64
Sau96I GGNCC 1 cut(s) 187
SchI GAGTC 1 cut(s) 218
ScrFI CCNGG 2 cut(s) 15, 129
SduI GDGCHC 2 cut(s) 21, 264
SetI ASST 5 cut(s) 81, 97, 140, 238, 270
SfcI CTRYAG 1 cut(s) 133
SinI GGWCC 1 cut(s) 187
SmiMI CAYNNNNRTG 1 cut(s) 255
SphI GCATGC 1 cut(s) 167
Sse9I AATT 2 cut(s) 28, 218
SspI AATATT 1 cut(s) 49
SspMI CTAG 1 cut(s) 271
StyD4I CCNGG 2 cut(s) 13, 127
TaiI ACGT 1 cut(s) 97
TaqI TCGA 1 cut(s) 238
TasI AATT 2 cut(s) 28, 218
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
TspDTI ATGAA 2 cut(s) 43, 87
VpaK11BI GGWCC 1 cut(s) 187
XceI RCATGY 1 cut(s) 167
XcmI CCANNNNNNNNNTGG 1 cut(s) 135
XspI CTAG 1 cut(s) 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.