Rh5CG546900

F-box kelch-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
76275769 .. 76276385
617 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG546900.1

Sequence Viewer

Length: 393 bp
ATGTTTCCAATGATGAAGGAGGAGCTGAGCTTTGACCTCCCCGAAGATGTTATTCTGAAGATTCTGTGGAGGTTGCCAGTCAAGTCTTTGATTCGATTCAGTTGTGTATCGAAACGCTGGCATACTATAATATTTTTTGACCCACAATTTGGAAAAGCTCACCTCAAAGTGGCATCTGAGCTGAGAACCATCACTAGGAGACTCCTCCTGCTCAAACGCTCAACACTTTATGCAATTAACACCCCCAAACAAAGTCCGAGGCTACAGTCCTCAGAAAACTCATTTAGAGGTAATTCTTTGGTCAGATGTCTGACCATGCCATCCGAGGAGAATATAACGAATGTAATGGCTATACAGTCCTTAGCACTCATTTGGAGAAAATTCTTTGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

15.21

Weight (kDa)

10.34

Isoelectric Point (pI)

80.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 12 - 44 5e-10 F-box domain
F-box-like PF12937 12 - 45 6.9e-09 F-box-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025005)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0076201
rosa_rugosa Rorug02G0105000
rosa_samantha Rh5CG546900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 149
AcsI RAATTY 1 cut(s) 380
AcuI CTGAAG 1 cut(s) 77
AfiI CCNNNNNNNGG 3 cut(s) 149, 169, 195
AluBI AGCT 4 cut(s) 25, 30, 158, 181
AluI AGCT 4 cut(s) 25, 30, 158, 181
Alw26I GTCTC 1 cut(s) 193
ApoI RAATTY 1 cut(s) 380
ArsI GACNNNNNNTTYG 2 cut(s) 131, 163
AsuHPI GGTGA 1 cut(s) 152
BccI CCATC 2 cut(s) 197, 328
BcoDI GTCTC 1 cut(s) 193
BfaI CTAG 1 cut(s) 195
BfmI CTRYAG 1 cut(s) 263
BlpI GCTNAGC 1 cut(s) 26
BmsI GCATC 1 cut(s) 182
Bpu10I CCTNAGC 1 cut(s) 361
Bpu1102I GCTNAGC 1 cut(s) 26
BsaJI CCNNGG 2 cut(s) 257, 324
Bsc4I CCNNNNNNNGG 3 cut(s) 149, 169, 195
Bse1I ACTGG 1 cut(s) 77
BseDI CCNNGG 2 cut(s) 257, 324
BseGI GGATG 1 cut(s) 320
BseLI CCNNNNNNNGG 3 cut(s) 149, 169, 195
BseMII CTCAG 4 cut(s) 17, 168, 173, 285
BseNI ACTGG 1 cut(s) 77
BseRI GAGGAG 3 cut(s) 35, 194, 341
BslI CCNNNNNNNGG 3 cut(s) 149, 169, 195
BsmAI GTCTC 1 cut(s) 193
Bsp1720I GCTNAGC 1 cut(s) 26
BspCNI CTCAG 4 cut(s) 18, 169, 174, 284
BsrI ACTGG 1 cut(s) 77
BssECI CCNNGG 2 cut(s) 257, 324
Bst4CI ACNGT 2 cut(s) 267, 357
BstC8I GCNNGC 1 cut(s) 119
BstDEI CTNAG 5 cut(s) 26, 177, 182, 271, 361
BstF5I GGATG 1 cut(s) 320
BstMAI GTCTC 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 263
BtsCI GGATG 1 cut(s) 320
Cac8I GCNNGC 1 cut(s) 119
CviAII CATG 1 cut(s) 316
CviJI RGCY 6 cut(s) 25, 30, 158, 181, 262, 350
CviKI_1 RGCY 6 cut(s) 25, 30, 158, 181, 262, 350
DdeI CTNAG 5 cut(s) 26, 177, 182, 271, 361
Eco57I CTGAAG 1 cut(s) 77
FaeI CATG 1 cut(s) 319
FaiI YATR 6 cut(s) 123, 128, 231, 317, 335, 353
FatI CATG 1 cut(s) 315
FokI GGATG 1 cut(s) 307
FspBI CTAG 1 cut(s) 195
Hin1II CATG 1 cut(s) 319
HinfI GANTC 4 cut(s) 61, 91, 96, 201
HphI GGTGA 1 cut(s) 152
Hpy188I TCNGA 7 cut(s) 57, 178, 258, 274, 305, 312, 325
HpyAV CCTTC 1 cut(s) 10
HpyCH4III ACNGT 2 cut(s) 267, 357
HpyCH4V TGCA 1 cut(s) 233
HpyF3I CTNAG 5 cut(s) 26, 177, 182, 271, 361
Hsp92II CATG 1 cut(s) 319
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 3 cut(s) 90, 103, 221
LweI GCATC 1 cut(s) 182
MaeI CTAG 1 cut(s) 195
MboII GAAGA 2 cut(s) 56, 70
MluCI AATT 4 cut(s) 146, 234, 292, 380
MlyI GAGTC 1 cut(s) 195
MnlI CCTC 9 cut(s) 13, 47, 63, 173, 215, 252, 280, 281, 319
MseI TTAA 1 cut(s) 237
NlaIII CATG 1 cut(s) 319
PfeI GAWTC 3 cut(s) 61, 91, 96
PflMI CCANNNNNTGG 1 cut(s) 149
PleI GAGTC 1 cut(s) 195
PpsI GAGTC 1 cut(s) 195
SaqAI TTAA 1 cut(s) 237
SchI GAGTC 1 cut(s) 195
SetI ASST 8 cut(s) 27, 32, 39, 74, 160, 165, 183, 292
SfaNI GCATC 1 cut(s) 182
SfcI CTRYAG 1 cut(s) 263
SgeI CNNG 9 cut(s) 53, 89, 94, 130, 207, 220, 270, 328, 337
Sse9I AATT 4 cut(s) 146, 234, 292, 380
SspI AATATT 1 cut(s) 132
SspMI CTAG 1 cut(s) 195
TaaI ACNGT 2 cut(s) 267, 357
TaqI TCGA 2 cut(s) 94, 110
TasI AATT 4 cut(s) 146, 234, 292, 380
TfiI GAWTC 3 cut(s) 61, 91, 96
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TspDTI ATGAA 1 cut(s) 29
Van91I CCANNNNNTGG 1 cut(s) 149
XapI RAATTY 1 cut(s) 380
XspI CTAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.