Rh5DG036000

endoplasmic reticulum protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
2534607 .. 2535029
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG036000.1

Sequence Viewer

Length: 234 bp
ATGACAAAATCAAAGCATTTTACTGTTAGGAAGGTAGAAAAGTTTGAGAAGAAAATAACGGAGAGAGGAGCAGTGCCGGAGAAAACTGCCAAAAGGGGGAAGGTCGACTCTGCTATTGGCCATGTTCCATCAGAAGTTTTGCCTCGTTTCTGCTGTGGCTTCTTCATCTTTGTTGTCATAGGATCATCTCTGTTTCGGACAATTAGGACTGCTACTAGCGGAAGCCTGGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.57

Weight (kDa)

10.11

Isoelectric Point (pI)

24.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RAMP4 PF06624 9 - 70 5.4e-09 Ribosome associated membrane protein RAMP4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030158)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0004091
rosa_samantha Rh5DG036000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 105
AciI CCGC 1 cut(s) 219
AclWI GGATC 1 cut(s) 190
AcoI YGGCCR 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 96
AjnI CCWGG 1 cut(s) 225
AlwI GGATC 1 cut(s) 190
AoxI GGCC 1 cut(s) 118
BalI TGGCCA 1 cut(s) 120
BccI CCATC 1 cut(s) 136
BciT130I CCWGG 1 cut(s) 227
BfaI CTAG 1 cut(s) 216
Bme1390I CCNGG 1 cut(s) 227
BmrFI CCNGG 1 cut(s) 227
Bsc4I CCNNNNNNNGG 1 cut(s) 96
BseBI CCWGG 1 cut(s) 227
BseLI CCNNNNNNNGG 1 cut(s) 96
BseRI GAGGAG 1 cut(s) 81
BshFI GGCC 1 cut(s) 120
BsiSI CCGG 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 96
BsnI GGCC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 182
BspACI CCGC 1 cut(s) 219
BspANI GGCC 1 cut(s) 120
BspPI GGATC 1 cut(s) 190
BssMI GATC 1 cut(s) 182
Bst2UI CCWGG 1 cut(s) 227
Bst4CI ACNGT 1 cut(s) 25
BstKTI GATC 1 cut(s) 185
BstMBI GATC 1 cut(s) 182
BstNI CCWGG 1 cut(s) 227
BstSCI CCNGG 1 cut(s) 225
BsuRI GGCC 1 cut(s) 120
BtsI GCAGTG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 78
CviAII CATG 1 cut(s) 122
CviJI RGCY 3 cut(s) 120, 159, 225
CviKI_1 RGCY 3 cut(s) 120, 159, 225
DpnI GATC 1 cut(s) 184
DpnII GATC 1 cut(s) 182
EaeI YGGCCR 1 cut(s) 118
EcoRII CCWGG 1 cut(s) 225
FaeI CATG 1 cut(s) 125
FaiI YATR 2 cut(s) 123, 179
FatI CATG 1 cut(s) 121
FblI GTMKAC 1 cut(s) 105
FspBI CTAG 1 cut(s) 216
HaeIII GGCC 1 cut(s) 120
HapII CCGG 1 cut(s) 77
Hin1II CATG 1 cut(s) 125
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HinfI GANTC 1 cut(s) 107
HpaII CCGG 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 2 cut(s) 133, 198
Hpy8I GTNNAC 1 cut(s) 106
HpyAV CCTTC 2 cut(s) 25, 94
HpyCH4III ACNGT 1 cut(s) 25
Hsp92II CATG 1 cut(s) 125
Kzo9I GATC 1 cut(s) 182
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 2 cut(s) 90, 212
MaeI CTAG 1 cut(s) 216
MalI GATC 1 cut(s) 184
MboI GATC 1 cut(s) 182
MboII GAAGA 2 cut(s) 61, 154
MlsI TGGCCA 1 cut(s) 120
MluCI AATT 1 cut(s) 201
MluNI TGGCCA 1 cut(s) 120
MlyI GAGTC 1 cut(s) 101
MnlI CCTC 2 cut(s) 59, 153
Mox20I TGGCCA 1 cut(s) 120
MscI TGGCCA 1 cut(s) 120
Msp20I TGGCCA 1 cut(s) 120
MspI CCGG 1 cut(s) 77
MspR9I CCNGG 1 cut(s) 227
MvaI CCWGG 1 cut(s) 227
NdeII GATC 1 cut(s) 182
NlaIII CATG 1 cut(s) 125
PleI GAGTC 1 cut(s) 101
PpsI GAGTC 1 cut(s) 101
Psp6I CCWGG 1 cut(s) 225
PspGI CCWGG 1 cut(s) 225
SalI GTCGAC 1 cut(s) 104
Sau3AI GATC 1 cut(s) 182
SchI GAGTC 1 cut(s) 101
ScrFI CCNGG 1 cut(s) 227
SetI ASST 2 cut(s) 36, 105
SgeI CNNG 4 cut(s) 89, 134, 156, 228
Sse9I AATT 1 cut(s) 201
SsiI CCGC 1 cut(s) 219
SspMI CTAG 1 cut(s) 216
StyD4I CCNGG 1 cut(s) 225
TaaI ACNGT 1 cut(s) 25
TaqI TCGA 1 cut(s) 105
TasI AATT 1 cut(s) 201
TscAI CASTG 1 cut(s) 78
TspDTI ATGAA 1 cut(s) 154
TspGWI ACGGA 1 cut(s) 74
TspRI CASTG 1 cut(s) 78
XmiI GTMKAC 1 cut(s) 105
XspI CTAG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.