Rh5DG228400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
25787644 .. 25798454
10811 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG228400.1

Sequence Viewer

Length: 156 bp
ATGGCTGGAGCCATTGTCTTGGCAGATTGTGGTGACAGAGGCTGCGATTCTAATTGGGAATCGGAGGTGTTAGTGGTGGTTGTGGAGGCGGCAGAGGAGTATGGTTCCAGTGAAGGAAGACAAGGTTCTGATAGAGATGTGGCTGTAGTCGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.3

Weight (kDa)

4.05

Isoelectric Point (pI)

31.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030168)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0032031
rosa_samantha Rh5DG228400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AlwNI CAGNNNCTG 1 cut(s) 42
ApeKI GCWGC 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 44
BbsI GAAGAC 1 cut(s) 124
BbvI GCAGC 1 cut(s) 29
BfmI CTRYAG 1 cut(s) 144
BisI GCNGC 2 cut(s) 43, 90
BlsI GCNGC 2 cut(s) 44, 91
BmiI GGNNCC 2 cut(s) 10, 106
BpiI GAAGAC 1 cut(s) 124
BpmI CTGGAG 1 cut(s) 27
BsaXI ACNNNNNCTCC 1 cut(s) 30
Bse1I ACTGG 1 cut(s) 108
BseNI ACTGG 1 cut(s) 108
BseRI GAGGAG 1 cut(s) 110
BseXI GCAGC 1 cut(s) 29
BspACI CCGC 1 cut(s) 89
BspLI GGNNCC 2 cut(s) 10, 106
BsrI ACTGG 1 cut(s) 108
BstSFI CTRYAG 1 cut(s) 144
BstV1I GCAGC 1 cut(s) 29
BstV2I GAAGAC 1 cut(s) 124
BstXI CCANNNNNNTGG 1 cut(s) 19
BtsIMutI CAGTG 1 cut(s) 115
CaiI CAGNNNCTG 1 cut(s) 42
CviJI RGCY 4 cut(s) 5, 11, 42, 143
CviKI_1 RGCY 4 cut(s) 5, 11, 42, 143
FaiI YATR 1 cut(s) 102
Fnu4HI GCNGC 2 cut(s) 43, 90
Fsp4HI GCNGC 2 cut(s) 43, 90
GluI GCNGC 2 cut(s) 43, 90
GsuI CTGGAG 1 cut(s) 27
HinfI GANTC 2 cut(s) 47, 59
HphI GGTGA 1 cut(s) 44
Hpy188I TCNGA 2 cut(s) 64, 130
HpyAV CCTTC 1 cut(s) 107
LmnI GCTCC 1 cut(s) 8
LpnPI CCDG 1 cut(s) 121
Lsp1109I GCAGC 1 cut(s) 29
MaeIII GTNAC 1 cut(s) 32
MboII GAAGA 1 cut(s) 129
MluCI AATT 1 cut(s) 52
MnlI CCTC 4 cut(s) 32, 58, 79, 88
NlaIV GGNNCC 2 cut(s) 10, 106
NmuCI GTSAC 1 cut(s) 32
PfeI GAWTC 2 cut(s) 47, 59
PkrI GCNGC 2 cut(s) 44, 91
PspN4I GGNNCC 2 cut(s) 10, 106
PstNI CAGNNNCTG 1 cut(s) 42
SatI GCNGC 2 cut(s) 43, 90
SetI ASST 2 cut(s) 69, 127
SfcI CTRYAG 1 cut(s) 144
SgeI CNNG 4 cut(s) 18, 31, 120, 134
Sse9I AATT 1 cut(s) 52
SsiI CCGC 1 cut(s) 89
TasI AATT 1 cut(s) 52
TauI GCSGC 1 cut(s) 92
TfiI GAWTC 2 cut(s) 47, 59
TscAI CASTG 1 cut(s) 115
TseFI GTSAC 1 cut(s) 32
TseI GCWGC 1 cut(s) 42
Tsp45I GTSAC 1 cut(s) 32
TspRI CASTG 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.