Rh6AG136500

Belongs to the mitochondrial carrier (TC 2.A.29) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
20793860 .. 20794203
344 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG136500.1

Sequence Viewer

Length: 273 bp
ATGGCTCTTAAAGCTTTAGAATCTGGTTTTATCCTTCAGTTCCAAGATGGAAATATAGGCAGTTCTCTAGCAATAACAGTGGCAACTCCAACTGAACTTGTAAAAGTTAGACTTCGAGCTGAGAGAAAATTACCACCAGGCGCACAAAGGCGCTATTCTGGCACATTGAATGCGTCTTCCACCATCTTGAGACAAGTTGTGATTGATGGCTTAAGAGATCGAAAGATTGCTTATCAGCTTTGCCTACAAGAGAGCTTCTGCAAGAGCAAATGA

Protein Analysis

90

Amino Acids

9.94

Weight (kDa)

10.02

Isoelectric Point (pI)

53.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029728)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0147221
rosa_samantha Rh6AG136500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 20
AflII CTTAAG 1 cut(s) 211
AgsI TTSAA 1 cut(s) 169
AjnI CCWGG 1 cut(s) 136
AluBI AGCT 4 cut(s) 14, 119, 238, 255
AluI AGCT 4 cut(s) 14, 119, 238, 255
Alw26I GTCTC 1 cut(s) 184
AspLEI GCGC 2 cut(s) 143, 153
BbsI GAAGAC 1 cut(s) 168
BccI CCATC 3 cut(s) 41, 191, 200
BciT130I CCWGG 1 cut(s) 138
BcoDI GTCTC 1 cut(s) 184
BfaI CTAG 1 cut(s) 68
BfoI RGCGCY 1 cut(s) 154
BfrI CTTAAG 1 cut(s) 211
Bme1390I CCNGG 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 138
BpiI GAAGAC 1 cut(s) 168
BpuEI CTTGAG 1 cut(s) 208
BseBI CCWGG 1 cut(s) 138
BseMII CTCAG 1 cut(s) 111
BsmAI GTCTC 1 cut(s) 184
BsmI GAATGC 1 cut(s) 175
Bsp143I GATC 1 cut(s) 217
BspCNI CTCAG 1 cut(s) 112
BspTI CTTAAG 1 cut(s) 211
BssMI GATC 1 cut(s) 217
Bst2UI CCWGG 1 cut(s) 138
Bst4CI ACNGT 1 cut(s) 79
BstAFI CTTAAG 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 120
BstH2I RGCGCY 1 cut(s) 154
BstHHI GCGC 2 cut(s) 143, 153
BstKTI GATC 1 cut(s) 220
BstMAI GTCTC 1 cut(s) 184
BstMBI GATC 1 cut(s) 217
BstMWI GCNNNNNNNGC 2 cut(s) 11, 159
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BstV2I GAAGAC 1 cut(s) 168
BtsIMutI CAGTG 1 cut(s) 84
CfoI GCGC 2 cut(s) 143, 153
CseI GACGC 1 cut(s) 162
CspCI CAANNNNNGTGG 2 cut(s) 60, 95
CviJI RGCY 6 cut(s) 5, 14, 119, 210, 238, 255
CviKI_1 RGCY 6 cut(s) 5, 14, 119, 210, 238, 255
DdeI CTNAG 1 cut(s) 120
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
Eco57I CTGAAG 1 cut(s) 20
EcoRII CCWGG 1 cut(s) 136
FaiI YATR 1 cut(s) 56
FalI AAGNNNNNCTT 2 cut(s) 96, 128
FspBI CTAG 1 cut(s) 68
GlaI GCGC 2 cut(s) 142, 152
HaeII RGCGCY 1 cut(s) 154
HgaI GACGC 1 cut(s) 162
HhaI GCGC 2 cut(s) 143, 153
Hin6I GCGC 2 cut(s) 141, 151
HinP1I GCGC 2 cut(s) 141, 151
HindIII AAGCTT 1 cut(s) 12
HinfI GANTC 1 cut(s) 20
Hpy188III TCNNGA 1 cut(s) 187
HpyAV CCTTC 1 cut(s) 44
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 261
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 159
HpyF3I CTNAG 1 cut(s) 120
HspAI GCGC 2 cut(s) 141, 151
Kzo9I GATC 1 cut(s) 217
LpnPI CCDG 4 cut(s) 9, 123, 144, 150
MaeI CTAG 1 cut(s) 68
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MboII GAAGA 1 cut(s) 168
MluCI AATT 1 cut(s) 128
MmeI TCCRAC 1 cut(s) 113
MseI TTAA 2 cut(s) 9, 212
MspCI CTTAAG 1 cut(s) 211
MspR9I CCNGG 1 cut(s) 138
Mva1269I GAATGC 1 cut(s) 175
MvaI CCWGG 1 cut(s) 138
MwoI GCNNNNNNNGC 2 cut(s) 11, 159
NdeII GATC 1 cut(s) 217
PctI GAATGC 1 cut(s) 175
PfeI GAWTC 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 136
PspGI CCWGG 1 cut(s) 136
SaqAI TTAA 2 cut(s) 9, 212
Sau3AI GATC 1 cut(s) 217
ScrFI CCNGG 1 cut(s) 138
SetI ASST 4 cut(s) 16, 121, 240, 257
SmlI CTYRAG 2 cut(s) 187, 211
SmoI CTYRAG 2 cut(s) 187, 211
Sse9I AATT 1 cut(s) 128
SspMI CTAG 1 cut(s) 68
StyD4I CCNGG 1 cut(s) 136
TaaI ACNGT 1 cut(s) 79
TaqI TCGA 2 cut(s) 115, 220
TasI AATT 1 cut(s) 128
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 2 cut(s) 9, 212
Tru9I TTAA 2 cut(s) 9, 212
TscAI CASTG 1 cut(s) 84
TspRI CASTG 1 cut(s) 84
Vha464I CTTAAG 1 cut(s) 211
XspI CTAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.