Rh6BG145200

Serine/Threonine protein kinases, catalytic domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
23251293 .. 23252717
1425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG145200.1

Sequence Viewer

Length: 225 bp
ATGACTAGAGTATCGTACGGCAGTGGTTATGCAGAAACCAAAAAGAGGACCAAGCCCATTGTTGTGGAAATAGATGATGAGGTGAGGGAGGTTATGTTTGTGTTTCACATAAATCGGCAATCTCTCACCGATTTCAAACTTGCCAAAAAGGCAGGGCCAACCGGAAACAGAGTCAAAGTCCAGGGAACTCCGCTGTACATGTCGTCAGAATCAGTGAACAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.37

Weight (kDa)

9.75

Isoelectric Point (pI)

43.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0033345)

Species Orthologous Gene IDs
rosa_samantha Rh6BG145200 Rh6DG129500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 191
AfaI GTAC 2 cut(s) 17, 197
AfiI CCNNNNNNNGG 1 cut(s) 45
AflIII ACRYGT 1 cut(s) 198
AgsI TTSAA 1 cut(s) 136
AjnI CCWGG 1 cut(s) 180
AoxI GGCC 1 cut(s) 155
AspS9I GGNCC 2 cut(s) 48, 155
AsuHPI GGTGA 2 cut(s) 94, 118
AvaII GGWCC 1 cut(s) 48
BaeI ACNNNNGTAYC 1 cut(s) 27
BceAI ACGGC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 182
BfaI CTAG 1 cut(s) 6
BglI GCCNNNNNGGC 1 cut(s) 149
Bme1390I CCNGG 1 cut(s) 182
Bme18I GGWCC 1 cut(s) 48
BmgT120I GGNCC 2 cut(s) 48, 155
BmrFI CCNGG 1 cut(s) 182
BsaJI CCNNGG 1 cut(s) 181
BsaWI WCCGGW 1 cut(s) 161
BsaXI ACNNNNNCTCC 2 cut(s) 80, 110
Bsc4I CCNNNNNNNGG 1 cut(s) 45
BseBI CCWGG 1 cut(s) 182
BseDI CCNNGG 1 cut(s) 181
BseLI CCNNNNNNNGG 1 cut(s) 45
BshFI GGCC 1 cut(s) 157
BsiSI CCGG 1 cut(s) 162
BsiWI CGTACG 1 cut(s) 15
BslI CCNNNNNNNGG 1 cut(s) 45
BsnI GGCC 1 cut(s) 157
Bsp1407I TGTACA 1 cut(s) 195
BspACI CCGC 1 cut(s) 191
BspANI GGCC 1 cut(s) 157
BsrGI TGTACA 1 cut(s) 195
BssECI CCNNGG 1 cut(s) 181
Bst2UI CCWGG 1 cut(s) 182
BstAUI TGTACA 1 cut(s) 195
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstNI CCWGG 1 cut(s) 182
BstNSI RCATGY 1 cut(s) 202
BstSCI CCNGG 1 cut(s) 180
BstXI CCANNNNNNTGG 1 cut(s) 64
BsuRI GGCC 1 cut(s) 157
BtsI GCAGTG 1 cut(s) 28
BtsIMutI CAGTG 2 cut(s) 28, 219
Cfr13I GGNCC 2 cut(s) 48, 155
Csp6I GTAC 2 cut(s) 16, 196
CviAII CATG 1 cut(s) 199
CviJI RGCY 2 cut(s) 55, 157
CviKI_1 RGCY 2 cut(s) 55, 157
CviQI GTAC 2 cut(s) 16, 196
Eco47I GGWCC 1 cut(s) 48
EcoRII CCWGG 1 cut(s) 180
FaeI CATG 1 cut(s) 202
FaiI YATR 4 cut(s) 30, 95, 110, 200
FatI CATG 1 cut(s) 198
FspBI CTAG 1 cut(s) 6
HaeIII GGCC 1 cut(s) 157
HapII CCGG 1 cut(s) 162
Hin1II CATG 1 cut(s) 202
HinfI GANTC 2 cut(s) 171, 209
HpaII CCGG 1 cut(s) 162
HphI GGTGA 2 cut(s) 94, 118
Hpy166II GTNNAC 1 cut(s) 217
Hpy188I TCNGA 1 cut(s) 208
Hpy8I GTNNAC 1 cut(s) 217
HpyCH4V TGCA 1 cut(s) 32
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
Hsp92II CATG 1 cut(s) 202
LpnPI CCDG 4 cut(s) 138, 167, 175, 194
MaeI CTAG 1 cut(s) 6
MlyI GAGTC 1 cut(s) 180
MnlI CCTC 4 cut(s) 39, 73, 78, 82
MslI CAYNNNNRTG 1 cut(s) 62
MspA1I CMGCKG 1 cut(s) 193
MspI CCGG 1 cut(s) 162
MspR9I CCNGG 1 cut(s) 182
MvaI CCWGG 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 149
NlaIII CATG 1 cut(s) 202
NspI RCATGY 1 cut(s) 202
PciI ACATGT 1 cut(s) 198
PfeI GAWTC 1 cut(s) 209
Pfl23II CGTACG 1 cut(s) 15
PleI GAGTC 1 cut(s) 179
PpsI GAGTC 1 cut(s) 179
PscI ACATGT 1 cut(s) 198
Psp6I CCWGG 1 cut(s) 180
PspGI CCWGG 1 cut(s) 180
PspLI CGTACG 1 cut(s) 15
PspPI GGNCC 2 cut(s) 48, 155
RsaI GTAC 2 cut(s) 17, 197
RsaNI GTAC 2 cut(s) 16, 196
RseI CAYNNNNRTG 1 cut(s) 62
Sau96I GGNCC 2 cut(s) 48, 155
SchI GAGTC 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 182
SetI ASST 2 cut(s) 84, 93
SgeI CNNG 8 cut(s) 18, 64, 152, 165, 174, 193, 194, 211
SinI GGWCC 1 cut(s) 48
SmiMI CAYNNNNRTG 1 cut(s) 62
SsiI CCGC 1 cut(s) 191
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 180
TatI WGTACW 1 cut(s) 195
TfiI GAWTC 1 cut(s) 209
TscAI CASTG 2 cut(s) 28, 219
TspRI CASTG 2 cut(s) 28, 219
VpaK11BI GGWCC 1 cut(s) 48
XceI RCATGY 1 cut(s) 202
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.