Rh7AG389700
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
51054981 .. 51055988
1008 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG389700.1

Sequence Viewer

Length: 249 bp
ATGAGAGTACCAGCTGTTCTCCTCCCTGTTGTTCTTGATGATAAAGTGGCAGATGAAAATATCCAGGATGACATGATCAAGGTTTTGAAGGTAGCTATTCTTTGTACTACCAAGCTTCCATCCCTGCGGCCTACAATGCGAGAGGTGATCAAGATGCTTATTGATGCTGATCCTGGCACTTTCACCTCTCCAAGCAACAATTCTGTCAAAGAAGGCAAGGATTCCTCCAGTCTGCTTCTCTCCCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

8.95

Weight (kDa)

5.19

Isoelectric Point (pI)

50.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020617)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 127
AclWI GGATC 1 cut(s) 164
AfaI GTAC 2 cut(s) 9, 106
AgsI TTSAA 1 cut(s) 88
AjnI CCWGG 2 cut(s) 63, 172
AjuI GAANNNNNNNTTGG 2 cut(s) 184, 216
AluBI AGCT 3 cut(s) 14, 95, 115
AluI AGCT 3 cut(s) 14, 95, 115
AlwI GGATC 1 cut(s) 164
AoxI GGCC 1 cut(s) 128
AsuHPI GGTGA 2 cut(s) 157, 175
BccI CCATC 1 cut(s) 127
BciT130I CCWGG 2 cut(s) 65, 174
BclI TGATCA 2 cut(s) 75, 147
BisI GCNGC 1 cut(s) 128
BlsI GCNGC 1 cut(s) 129
Bme1390I CCNGG 2 cut(s) 65, 174
BmrFI CCNGG 2 cut(s) 65, 174
BmrI ACTGGG 1 cut(s) 238
BmsI GCATC 2 cut(s) 144, 154
BmuI ACTGGG 1 cut(s) 238
BpmI CTGGAG 1 cut(s) 211
BsaBI GATNNNNATC 1 cut(s) 168
Bse1I ACTGG 2 cut(s) 228, 244
Bse8I GATNNNNATC 1 cut(s) 168
BseBI CCWGG 2 cut(s) 65, 174
BseGI GGATG 2 cut(s) 73, 119
BseJI GATNNNNATC 1 cut(s) 168
BseNI ACTGG 2 cut(s) 228, 244
BseRI GAGGAG 1 cut(s) 11
BshFI GGCC 1 cut(s) 130
BsnI GGCC 1 cut(s) 130
Bsp143I GATC 3 cut(s) 75, 147, 169
BspACI CCGC 1 cut(s) 127
BspANI GGCC 1 cut(s) 130
BspPI GGATC 1 cut(s) 164
BsrI ACTGG 2 cut(s) 228, 244
BssMI GATC 3 cut(s) 75, 147, 169
Bst2UI CCWGG 2 cut(s) 65, 174
BstF5I GGATG 2 cut(s) 73, 119
BstKTI GATC 3 cut(s) 78, 150, 172
BstMBI GATC 3 cut(s) 75, 147, 169
BstMWI GCNNNNNNNGC 1 cut(s) 136
BstNI CCWGG 2 cut(s) 65, 174
BstSCI CCNGG 2 cut(s) 63, 172
BsuRI GGCC 1 cut(s) 130
BtsCI GGATG 2 cut(s) 73, 119
Csp6I GTAC 2 cut(s) 8, 105
CviAII CATG 1 cut(s) 73
CviJI RGCY 4 cut(s) 14, 95, 115, 130
CviKI_1 RGCY 4 cut(s) 14, 95, 115, 130
CviQI GTAC 2 cut(s) 8, 105
DpnI GATC 3 cut(s) 77, 149, 171
DpnII GATC 3 cut(s) 75, 147, 169
EcoRII CCWGG 2 cut(s) 63, 172
FaeI CATG 1 cut(s) 76
FaiI YATR 1 cut(s) 74
FatI CATG 1 cut(s) 72
FbaI TGATCA 2 cut(s) 75, 147
Fnu4HI GCNGC 1 cut(s) 128
FokI GGATG 2 cut(s) 80, 106
Fsp4HI GCNGC 1 cut(s) 128
GluI GCNGC 1 cut(s) 128
GsuI CTGGAG 1 cut(s) 211
HaeIII GGCC 1 cut(s) 130
Hin1II CATG 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 113
HinfI GANTC 1 cut(s) 221
HphI GGTGA 2 cut(s) 157, 175
Hpy188III TCNNGA 2 cut(s) 35, 151
HpyAV CCTTC 2 cut(s) 82, 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 136
Hsp92II CATG 1 cut(s) 76
Ksp22I TGATCA 2 cut(s) 75, 147
Kzo9I GATC 3 cut(s) 75, 147, 169
LpnPI CCDG 8 cut(s) 24, 39, 50, 77, 137, 159, 186, 241
LweI GCATC 2 cut(s) 144, 154
MalI GATC 3 cut(s) 77, 149, 171
MboI GATC 3 cut(s) 75, 147, 169
MluCI AATT 1 cut(s) 199
MnlI CCTC 4 cut(s) 32, 136, 196, 235
MspA1I CMGCKG 1 cut(s) 14
MspR9I CCNGG 2 cut(s) 65, 174
MvaI CCWGG 2 cut(s) 65, 174
MwoI GCNNNNNNNGC 1 cut(s) 136
NdeII GATC 3 cut(s) 75, 147, 169
NlaIII CATG 1 cut(s) 76
PfeI GAWTC 1 cut(s) 221
PfoI TCCNGGA 1 cut(s) 63
PkrI GCNGC 1 cut(s) 129
Psp6I CCWGG 2 cut(s) 63, 172
PspGI CCWGG 2 cut(s) 63, 172
PsrI GAACNNNNNNTAC 1 cut(s) 32
PvuII CAGCTG 1 cut(s) 14
RsaI GTAC 2 cut(s) 9, 106
RsaNI GTAC 2 cut(s) 8, 105
SatI GCNGC 1 cut(s) 128
Sau3AI GATC 3 cut(s) 75, 147, 169
ScrFI CCNGG 2 cut(s) 65, 174
SetI ASST 7 cut(s) 16, 84, 93, 97, 117, 147, 188
SfaNI GCATC 2 cut(s) 144, 154
Sse9I AATT 1 cut(s) 199
SsiI CCGC 1 cut(s) 127
StyD4I CCNGG 2 cut(s) 63, 172
TasI AATT 1 cut(s) 199
TatI WGTACW 1 cut(s) 104
TauI GCSGC 1 cut(s) 130
TfiI GAWTC 1 cut(s) 221
TspDTI ATGAA 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.