Rh7BG372300

DnaJ homolog subfamily B member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0025105
Physical Location & Seq
Forward (+)
40002452 .. 40002724
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG372300.1

Sequence Viewer

Length: 273 bp
ATGGGAATTGATCACTACAAAATACTTGGTGTGAATCGCAACGCAAGCCCGGATGTGGTGAAGAAAGCATATAAGAAACTGGTCATGTTTTGGCACCCTGACAAACACTTGCAGGAAGAAGCTCGAGCCAAGGCCGACGCCAAGTTCAAGGAAATCAACCAGGCTTACCAGATTCTCAACGACCCTGTGAAACGACATAACTACGATAGTCAGCATGCAAATATAGCCAACTCCAATTGGACGTACGACATCGTCATTTTGGTTTCCTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ DnaJ_C

Protein Analysis

90

Amino Acids

10.45

Weight (kDa)

9.19

Isoelectric Point (pI)

55.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 4 - 69 2.1e-24 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025105)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0226541
rosa_multiflora Rmu_sc0001423.1_g000018
rosa_samantha Rh7BG372300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 93
AcyI GRCGYC 1 cut(s) 138
AfaI GTAC 1 cut(s) 245
AfiI CCNNNNNNNGG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 148
AjnI CCWGG 1 cut(s) 159
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
Ama87I CYCGRG 1 cut(s) 123
AoxI GGCC 1 cut(s) 132
AsuC2I CCSGG 1 cut(s) 50
AsuHPI GGTGA 1 cut(s) 70
AvaI CYCGRG 1 cut(s) 123
BanI GGYRCC 1 cut(s) 93
BciT130I CCWGG 1 cut(s) 161
BclI TGATCA 1 cut(s) 10
BcnI CCSGG 1 cut(s) 50
BfaI CTAG 1 cut(s) 271
Bme1390I CCNGG 2 cut(s) 50, 161
BmeT110I CYCGRG 1 cut(s) 123
BmiI GGNNCC 1 cut(s) 95
BmrFI CCNGG 2 cut(s) 50, 161
BpuMI CCSGG 1 cut(s) 50
BsaHI GRCGYC 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 55
Bse1I ACTGG 1 cut(s) 84
BseBI CCWGG 1 cut(s) 161
BseDI CCNNGG 1 cut(s) 129
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 1 cut(s) 55
BseNI ACTGG 1 cut(s) 84
BshFI GGCC 1 cut(s) 134
BshNI GGYRCC 1 cut(s) 93
BsiHKCI CYCGRG 1 cut(s) 123
BsiSI CCGG 1 cut(s) 50
BsiWI CGTACG 1 cut(s) 243
BslI CCNNNNNNNGG 1 cut(s) 55
BsnI GGCC 1 cut(s) 134
BsoBI CYCGRG 1 cut(s) 123
Bsp143I GATC 1 cut(s) 10
BspANI GGCC 1 cut(s) 134
BspLI GGNNCC 1 cut(s) 95
BspT107I GGYRCC 1 cut(s) 93
BsrI ACTGG 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 129
BssMI GATC 1 cut(s) 10
BssNI GRCGYC 1 cut(s) 138
BssT1I CCWWGG 1 cut(s) 129
Bst2UI CCWGG 1 cut(s) 161
BstACI GRCGYC 1 cut(s) 138
BstC8I GCNNGC 2 cut(s) 46, 216
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 1 cut(s) 13
BstMBI GATC 1 cut(s) 10
BstMWI GCNNNNNNNGC 2 cut(s) 45, 224
BstNI CCWGG 1 cut(s) 161
BstNSI RCATGY 1 cut(s) 218
BstSCI CCNGG 2 cut(s) 48, 159
BsuRI GGCC 1 cut(s) 134
BtsCI GGATG 1 cut(s) 58
Cac8I GCNNGC 2 cut(s) 46, 216
CseI GACGC 1 cut(s) 146
Csp6I GTAC 1 cut(s) 244
CviAII CATG 2 cut(s) 85, 215
CviJI RGCY 6 cut(s) 48, 122, 128, 134, 164, 227
CviKI_1 RGCY 6 cut(s) 48, 122, 128, 134, 164, 227
CviQI GTAC 1 cut(s) 244
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
Eco130I CCWWGG 1 cut(s) 129
Eco88I CYCGRG 1 cut(s) 123
EcoRII CCWGG 1 cut(s) 159
EcoT14I CCWWGG 1 cut(s) 129
ErhI CCWWGG 1 cut(s) 129
FaeI CATG 2 cut(s) 88, 218
FaiI YATR 6 cut(s) 70, 72, 86, 198, 216, 224
FatI CATG 2 cut(s) 84, 214
FbaI TGATCA 1 cut(s) 10
FokI GGATG 1 cut(s) 65
FspBI CTAG 1 cut(s) 271
HaeIII GGCC 1 cut(s) 134
HapII CCGG 1 cut(s) 50
HgaI GACGC 1 cut(s) 146
Hin1I GRCGYC 1 cut(s) 138
Hin1II CATG 2 cut(s) 88, 218
HinfI GANTC 2 cut(s) 34, 172
HpaII CCGG 1 cut(s) 50
HphI GGTGA 1 cut(s) 70
Hpy99I CGWCG 1 cut(s) 140
HpyCH4IV ACGT 1 cut(s) 242
HpyCH4V TGCA 2 cut(s) 112, 218
HpyF10VI GCNNNNNNNGC 2 cut(s) 45, 224
HpySE526I ACGT 1 cut(s) 242
Hsp92I GRCGYC 1 cut(s) 138
Hsp92II CATG 2 cut(s) 88, 218
Ksp22I TGATCA 1 cut(s) 10
Kzo9I GATC 1 cut(s) 10
LpnPI CCDG 8 cut(s) 63, 65, 98, 111, 146, 173, 182, 198
MaeI CTAG 1 cut(s) 271
MaeII ACGT 1 cut(s) 242
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MboII GAAGA 2 cut(s) 73, 128
MfeI CAATTG 1 cut(s) 235
MluCI AATT 2 cut(s) 6, 235
MspI CCGG 1 cut(s) 50
MspR9I CCNGG 2 cut(s) 50, 161
MunI CAATTG 1 cut(s) 235
MvaI CCWGG 1 cut(s) 161
MwoI GCNNNNNNNGC 2 cut(s) 45, 224
NciI CCSGG 1 cut(s) 50
NdeII GATC 1 cut(s) 10
NlaIII CATG 2 cut(s) 88, 218
NlaIV GGNNCC 1 cut(s) 95
NspI RCATGY 1 cut(s) 218
PaeI GCATGC 1 cut(s) 218
PaeR7I CTCGAG 1 cut(s) 123
PfeI GAWTC 2 cut(s) 34, 172
Pfl23II CGTACG 1 cut(s) 243
PflFI GACNNNGTC 1 cut(s) 251
Psp6I CCWGG 1 cut(s) 159
PspGI CCWGG 1 cut(s) 159
PspLI CGTACG 1 cut(s) 243
PspN4I GGNNCC 1 cut(s) 95
PspXI VCTCGAGB 1 cut(s) 123
PsyI GACNNNGTC 1 cut(s) 251
RsaI GTAC 1 cut(s) 245
RsaNI GTAC 1 cut(s) 244
Sau3AI GATC 1 cut(s) 10
ScrFI CCNGG 2 cut(s) 50, 161
SetI ASST 2 cut(s) 124, 245
Sfr274I CTCGAG 1 cut(s) 123
SlaI CTCGAG 1 cut(s) 123
SmlI CTYRAG 1 cut(s) 123
SmoI CTYRAG 1 cut(s) 123
SphI GCATGC 1 cut(s) 218
Sse9I AATT 2 cut(s) 6, 235
SspMI CTAG 1 cut(s) 271
StyD4I CCNGG 2 cut(s) 48, 159
StyI CCWWGG 1 cut(s) 129
TaiI ACGT 1 cut(s) 245
TaqI TCGA 1 cut(s) 124
TasI AATT 2 cut(s) 6, 235
TfiI GAWTC 2 cut(s) 34, 172
Tth111I GACNNNGTC 1 cut(s) 251
XceI RCATGY 1 cut(s) 218
XhoI CTCGAG 1 cut(s) 123
XspI CTAG 1 cut(s) 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.