Rh7CG310000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
32771092 .. 32772193
1102 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG310000.1

Sequence Viewer

Length: 303 bp
ATGCAGAAGAAGAGGAGGAGGAGGGTAGTGAATAGGGGTTTATGGGTTTGTGAAGGAGTGGCTGGGAAAATTGGAAGAGGCCTGAGCCTAGATTTGGGCAATGGAAGTGAAGAAGATGACGGGGAATTGGTCTCCATCGCTCTGCCAGCAATGAAGGAGAGAGTTAGAGGATTTTTTATTTTTTTTTTGTTCTCAAACTTTAATCTCTTGTTCCTTCAATCTTTGCTCTGTGAATCTTTGATTAAAGAGCAGGCTAAAATCCAAATGAGAGTAATTTTAATATGCCCCGTTGTTAGAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.4

Weight (kDa)

9.56

Isoelectric Point (pI)

48.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030229)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0081801
rosa_samantha Rh7CG310000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 1 cut(s) 218
Alw26I GTCTC 1 cut(s) 136
AoxI GGCC 1 cut(s) 79
BccI CCATC 1 cut(s) 143
BcoDI GTCTC 1 cut(s) 136
BfaI CTAG 1 cut(s) 89
Bpu10I CCTNAGC 1 cut(s) 83
BsaI GGTCTC 1 cut(s) 136
Bsc4I CCNNNNNNNGG 1 cut(s) 94
Bse3DI GCAATG 2 cut(s) 106, 156
BseLI CCNNNNNNNGG 1 cut(s) 94
BseMI GCAATG 2 cut(s) 106, 156
BseMII CTCAG 1 cut(s) 74
BseRI GAGGAG 3 cut(s) 28, 31, 34
BseYI CCCAGC 1 cut(s) 62
BshFI GGCC 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 94
BsmAI GTCTC 1 cut(s) 136
BsnI GGCC 1 cut(s) 81
Bso31I GGTCTC 1 cut(s) 136
BspANI GGCC 1 cut(s) 81
BspCNI CTCAG 1 cut(s) 75
BspTNI GGTCTC 1 cut(s) 136
BsrDI GCAATG 2 cut(s) 106, 156
Bst6I CTCTTC 2 cut(s) 5, 70
BstC8I GCNNGC 2 cut(s) 147, 252
BstDEI CTNAG 1 cut(s) 83
BstMAI GTCTC 1 cut(s) 136
BstMWI GCNNNNNNNGC 1 cut(s) 146
BsuRI GGCC 1 cut(s) 81
BtgZI GCGATG 1 cut(s) 121
Cac8I GCNNGC 2 cut(s) 147, 252
CviJI RGCY 4 cut(s) 62, 81, 87, 254
CviKI_1 RGCY 4 cut(s) 62, 81, 87, 254
DdeI CTNAG 1 cut(s) 83
Eam1104I CTCTTC 2 cut(s) 5, 70
EarI CTCTTC 2 cut(s) 5, 70
Eco147I AGGCCT 1 cut(s) 81
Eco31I GGTCTC 1 cut(s) 136
FaiI YATR 2 cut(s) 43, 283
FspBI CTAG 1 cut(s) 89
GsaI CCCAGC 1 cut(s) 66
HaeIII GGCC 1 cut(s) 81
HinfI GANTC 1 cut(s) 233
HpyAV CCTTC 3 cut(s) 47, 148, 224
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 83
LpnPI CCDG 4 cut(s) 48, 95, 159, 236
MaeI CTAG 1 cut(s) 89
MboII GAAGA 5 cut(s) 19, 22, 87, 122, 125
MluCI AATT 3 cut(s) 69, 125, 273
MnlI CCTC 6 cut(s) 6, 9, 12, 15, 71, 161
MseI TTAA 3 cut(s) 201, 243, 278
MwoI GCNNNNNNNGC 1 cut(s) 146
PceI AGGCCT 1 cut(s) 81
PfeI GAWTC 1 cut(s) 233
PspFI CCCAGC 1 cut(s) 62
SaqAI TTAA 3 cut(s) 201, 243, 278
SgeI CNNG 8 cut(s) 75, 94, 101, 133, 158, 220, 263, 299
Sse9I AATT 3 cut(s) 69, 125, 273
SseBI AGGCCT 1 cut(s) 81
SspMI CTAG 1 cut(s) 89
StuI AGGCCT 1 cut(s) 81
TasI AATT 3 cut(s) 69, 125, 273
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 3 cut(s) 201, 243, 278
Tru9I TTAA 3 cut(s) 201, 243, 278
TspDTI ATGAA 1 cut(s) 167
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.