Rw0G001110

U3 small nucleolar ribonucleoprotein protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00036
OG0029694
Physical Location & Seq
Forward (+)
98258 .. 100621
2364 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G001110.1

Sequence Viewer

Length: 228 bp
ATGCATTCAATATTGAAACTATGCCCTGTGCCAAAGCCAGATACAAAACGCATAATCACTTTTTCGAATGAGCAGGACTACATTTCATTCAGGCATCATATTTATAACAAGCCTGGAGGTCCTAAATCCATTGAGCTGAAGGAGATTGGTCCGCAGTTTGAGTTGAAGCTTTTCAAGGTTAGGAGAATGCTTTCTCTTGGATATGTTATCTTCTTGGGTAATGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03008 map03008
Pfam Domains
Protein Families
Brix

Protein Analysis

75

Amino Acids

8.73

Weight (kDa)

9.78

Isoelectric Point (pI)

53.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Brix PF04427 8 - 59 2.9e-09 Brix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029694)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0320851
rosa_wichuraiana Rw0G001110

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 105
AciI CCGC 1 cut(s) 152
AcuI CTGAAG 1 cut(s) 158
AgsI TTSAA 4 cut(s) 9, 16, 166, 175
AjnI CCWGG 1 cut(s) 112
AluBI AGCT 2 cut(s) 136, 169
AluI AGCT 2 cut(s) 136, 169
Asp700I GAANNNNTTC 2 cut(s) 170, 190
AspS9I GGNCC 2 cut(s) 119, 149
AsuII TTCGAA 1 cut(s) 65
AvaII GGWCC 2 cut(s) 119, 149
BciT130I CCWGG 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 114
Bme18I GGWCC 2 cut(s) 119, 149
BmgT120I GGNCC 2 cut(s) 119, 149
BmrFI CCNGG 1 cut(s) 114
BmsI GCATC 1 cut(s) 103
BpmI CTGGAG 1 cut(s) 135
Bpu14I TTCGAA 1 cut(s) 65
BseBI CCWGG 1 cut(s) 114
BsmI GAATGC 2 cut(s) 4, 192
Bsp119I TTCGAA 1 cut(s) 65
BspACI CCGC 1 cut(s) 152
BspT104I TTCGAA 1 cut(s) 65
Bst2UI CCWGG 1 cut(s) 114
BstBI TTCGAA 1 cut(s) 65
BstNI CCWGG 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 112
Cfr13I GGNCC 2 cut(s) 119, 149
CviJI RGCY 4 cut(s) 37, 112, 136, 169
CviKI_1 RGCY 4 cut(s) 37, 112, 136, 169
Eco47I GGWCC 2 cut(s) 119, 149
Eco57I CTGAAG 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 112
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 5 cut(s) 22, 53, 99, 105, 204
GsuI CTGGAG 1 cut(s) 135
HindIII AAGCTT 1 cut(s) 167
HpyAV CCTTC 1 cut(s) 133
HpyCH4V TGCA 1 cut(s) 4
LpnPI CCDG 6 cut(s) 39, 51, 59, 76, 99, 126
LweI GCATC 1 cut(s) 103
MboII GAAGA 1 cut(s) 202
MnlI CCTC 1 cut(s) 110
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 2 cut(s) 170, 190
MspR9I CCNGG 1 cut(s) 114
Mva1269I GAATGC 2 cut(s) 4, 192
MvaI CCWGG 1 cut(s) 114
NsiI ATGCAT 1 cut(s) 6
NspV TTCGAA 1 cut(s) 65
PctI GAATGC 2 cut(s) 4, 192
PdmI GAANNNNTTC 2 cut(s) 170, 190
PpuMI RGGWCCY 1 cut(s) 119
PsiI TTATAA 1 cut(s) 105
Psp5II RGGWCCY 1 cut(s) 119
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
PspPI GGNCC 2 cut(s) 119, 149
PspPPI RGGWCCY 1 cut(s) 119
Sau96I GGNCC 2 cut(s) 119, 149
ScrFI CCNGG 1 cut(s) 114
SetI ASST 4 cut(s) 121, 138, 171, 180
SfaNI GCATC 1 cut(s) 103
SfuI TTCGAA 1 cut(s) 65
SgeI CNNG 9 cut(s) 38, 50, 86, 103, 121, 125, 126, 187, 209
SinI GGWCC 2 cut(s) 119, 149
SsiI CCGC 1 cut(s) 152
SspI AATATT 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 112
TaqI TCGA 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 75
VpaK11BI GGWCC 2 cut(s) 119, 149
XmnI GAANNNNTTC 2 cut(s) 170, 190
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.