Rw3G024490

TRAF-type zinc finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
OG0020518
Physical Location & Seq
Reverse (-)
31518725 .. 31519865
1141 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G024490.1

Sequence Viewer

Length: 447 bp
ATGATGCAGGAATTGTCAACCATTGATGATCTACTTGCAACTCATGTGGAACTTGAACCAGAAAAGATTGAAGATGGGAAAAATGGAGGTCCTTCATTCCATTCTGATCTTTACAACACGGAATTAGTCCACAACATAGCTCAAGGTTTCATTCCTGGATTAGCTGCTGCTTGTGTTGATAAGACATCTGGAGTTATCTTCAAGACCCCTGCTTCTGTGGCGGCCGATGTGAGAAAGGAAATGGTGGCCAAGATTGTTAAGTGTCTGATCATCCCTATGACATCATTTCTGATTTTGTTTGATGACTTTGCTAGCTCCAAGAGAAATTTATTTAAAGATAAAATAGATGATTTTGTTCAAGAGATGGAAATAAATGGGTTTTGGTTGGTTGATGAGATAGAAACAATAGCACAGAGTTTGGTAAAGAATGTCGACCTCAAGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00130 map00130
Pfam Domains
Protein Families
zf-TRAF

Protein Analysis

148

Amino Acids

16.45

Weight (kDa)

4.63

Isoelectric Point (pI)

32.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020518)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0486371
rosa_rugosa Rorug03G0224800
rosa_samantha Rh3AG274800 Rh3BG309900 Rh3CG309100
rosa_wichuraiana Rw3G024490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 432
AciI CCGC 1 cut(s) 221
AcoI YGGCCR 2 cut(s) 222, 246
AcsI RAATTY 1 cut(s) 325
AgsI TTSAA 4 cut(s) 56, 71, 202, 359
AjnI CCWGG 1 cut(s) 154
AluBI AGCT 3 cut(s) 140, 164, 315
AluI AGCT 3 cut(s) 140, 164, 315
AoxI GGCC 2 cut(s) 222, 246
ApeKI GCWGC 2 cut(s) 164, 167
ApoI RAATTY 1 cut(s) 325
AspS9I GGNCC 1 cut(s) 89
AsuNHI GCTAGC 1 cut(s) 311
AvaII GGWCC 1 cut(s) 89
BalI TGGCCA 1 cut(s) 248
BbvI GCAGC 2 cut(s) 151, 154
BccI CCATC 2 cut(s) 68, 358
BciT130I CCWGG 1 cut(s) 156
BclI TGATCA 1 cut(s) 267
BfaI CTAG 1 cut(s) 312
BisI GCNGC 3 cut(s) 165, 168, 222
BlsI GCNGC 3 cut(s) 166, 169, 223
Bme1390I CCNGG 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmrFI CCNGG 1 cut(s) 156
BmtI GCTAGC 1 cut(s) 315
BpmI CTGGAG 1 cut(s) 210
BpuEI CTTGAG 2 cut(s) 126, 422
BseBI CCWGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 270
BseX3I CGGCCG 1 cut(s) 222
BseXI GCAGC 2 cut(s) 151, 154
Bsh1285I CGRYCG 1 cut(s) 225
BshFI GGCC 2 cut(s) 224, 248
BsiEI CGRYCG 1 cut(s) 225
BsnI GGCC 2 cut(s) 224, 248
Bsp143I GATC 3 cut(s) 28, 106, 267
BspACI CCGC 1 cut(s) 221
BspANI GGCC 2 cut(s) 224, 248
BspOI GCTAGC 1 cut(s) 315
BssMI GATC 3 cut(s) 28, 106, 267
Bst2UI CCWGG 1 cut(s) 156
BstC8I GCNNGC 1 cut(s) 313
BstF5I GGATG 1 cut(s) 270
BstKTI GATC 3 cut(s) 31, 109, 270
BstMBI GATC 3 cut(s) 28, 106, 267
BstMCI CGRYCG 1 cut(s) 225
BstMWI GCNNNNNNNGC 1 cut(s) 218
BstNI CCWGG 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 154
BstV1I GCAGC 2 cut(s) 151, 154
BstZI CGGCCG 1 cut(s) 222
BsuRI GGCC 2 cut(s) 224, 248
BtsCI GGATG 1 cut(s) 270
Cac8I GCNNGC 1 cut(s) 313
Cfr13I GGNCC 1 cut(s) 89
CspCI CAANNNNNGTGG 2 cut(s) 27, 62
CviAII CATG 1 cut(s) 44
CviJI RGCY 5 cut(s) 140, 164, 224, 248, 315
CviKI_1 RGCY 5 cut(s) 140, 164, 224, 248, 315
DpnI GATC 3 cut(s) 30, 108, 269
DpnII GATC 3 cut(s) 28, 106, 267
DraI TTTAAA 1 cut(s) 334
EaeI YGGCCR 2 cut(s) 222, 246
EagI CGGCCG 1 cut(s) 222
EclXI CGGCCG 1 cut(s) 222
Eco47I GGWCC 1 cut(s) 89
Eco52I CGGCCG 1 cut(s) 222
EcoO109I RGGNCCY 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 154
FaeI CATG 1 cut(s) 47
FaiI YATR 3 cut(s) 45, 137, 278
FatI CATG 1 cut(s) 43
FbaI TGATCA 1 cut(s) 267
FblI GTMKAC 1 cut(s) 432
Fnu4HI GCNGC 3 cut(s) 165, 168, 222
FokI GGATG 1 cut(s) 257
Fsp4HI GCNGC 3 cut(s) 165, 168, 222
FspBI CTAG 1 cut(s) 312
GluI GCNGC 3 cut(s) 165, 168, 222
GsuI CTGGAG 1 cut(s) 210
HaeIII GGCC 2 cut(s) 224, 248
Hin1II CATG 1 cut(s) 47
HincII GTYRAC 2 cut(s) 18, 433
HindII GTYRAC 2 cut(s) 18, 433
Hpy166II GTNNAC 3 cut(s) 18, 130, 433
Hpy188I TCNGA 3 cut(s) 106, 267, 291
Hpy188III TCNNGA 4 cut(s) 189, 202, 359, 439
Hpy8I GTNNAC 3 cut(s) 18, 130, 433
HpyAV CCTTC 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 7, 38
HpyF10VI GCNNNNNNNGC 1 cut(s) 218
Hsp92II CATG 1 cut(s) 47
Ksp22I TGATCA 1 cut(s) 267
Kzo9I GATC 3 cut(s) 28, 106, 267
LmnI GCTCC 1 cut(s) 320
LpnPI CCDG 5 cut(s) 72, 141, 168, 174, 222
Lsp1109I GCAGC 2 cut(s) 151, 154
MaeI CTAG 1 cut(s) 312
MalI GATC 3 cut(s) 30, 108, 269
MboI GATC 3 cut(s) 28, 106, 267
MboII GAAGA 2 cut(s) 83, 190
MlsI TGGCCA 1 cut(s) 248
MluCI AATT 4 cut(s) 11, 122, 325, 442
MluNI TGGCCA 1 cut(s) 248
MnlI CCTC 2 cut(s) 80, 446
Mox20I TGGCCA 1 cut(s) 248
MscI TGGCCA 1 cut(s) 248
MseI TTAA 2 cut(s) 258, 333
MslI CAYNNNNRTG 1 cut(s) 275
Msp20I TGGCCA 1 cut(s) 248
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
MwoI GCNNNNNNNGC 1 cut(s) 218
NdeII GATC 3 cut(s) 28, 106, 267
NheI GCTAGC 1 cut(s) 311
NlaIII CATG 1 cut(s) 47
PfoI TCCNGGA 1 cut(s) 154
PkrI GCNGC 3 cut(s) 166, 169, 223
PpuMI RGGWCCY 1 cut(s) 89
Psp5II RGGWCCY 1 cut(s) 89
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
PspPI GGNCC 1 cut(s) 89
PspPPI RGGWCCY 1 cut(s) 89
RseI CAYNNNNRTG 1 cut(s) 275
SalI GTCGAC 1 cut(s) 431
SaqAI TTAA 2 cut(s) 258, 333
SatI GCNGC 3 cut(s) 165, 168, 222
Sau3AI GATC 3 cut(s) 28, 106, 267
Sau96I GGNCC 1 cut(s) 89
ScrFI CCNGG 1 cut(s) 156
SetI ASST 6 cut(s) 91, 142, 148, 166, 317, 438
SinI GGWCC 1 cut(s) 89
SmiMI CAYNNNNRTG 1 cut(s) 275
SmlI CTYRAG 2 cut(s) 141, 437
SmoI CTYRAG 2 cut(s) 141, 437
Sse9I AATT 4 cut(s) 11, 122, 325, 442
SsiI CCGC 1 cut(s) 221
SspMI CTAG 1 cut(s) 312
StyD4I CCNGG 1 cut(s) 154
TaqI TCGA 1 cut(s) 432
TasI AATT 4 cut(s) 11, 122, 325, 442
TauI GCSGC 1 cut(s) 224
Tru1I TTAA 2 cut(s) 258, 333
Tru9I TTAA 2 cut(s) 258, 333
TseI GCWGC 2 cut(s) 164, 167
TspDTI ATGAA 2 cut(s) 84, 139
TspGWI ACGGA 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 89
XapI RAATTY 1 cut(s) 325
XmiI GTMKAC 1 cut(s) 432
XspI CTAG 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.