AT2G07751

Ribosomal protein S12/S23

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0023963
Physical Location & Seq
Forward (+)
3270008 .. 3270364
357 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G07751.1

Sequence Viewer

Length: 357 bp
ATGTCAGAATTTGCACCAATTTCTATCTATTTAGTGATTAGTCTGCTAGTTTCTTTGATCCTACTCGGTGTTCCTTTTCCATTTGCTTCCAATAGTTCTACCTACCCAGAAAAATTGTCGGCCTACGAATGTGGTTTCGATCCTTCCGGTGATGCCAGAAGTCGTTTCGATATACGATTTTATCTTGTTTCAATTTTATTTTTAATCCCTGATCTGGAAGTAACCTTTTTCTTTCCTTGGGCAGTACCTCCCAACAAGATTGATCTGTTTGGATTTTGGTCCATGATGGCCTTTTTATTTATTTTGACGATTGGATTTCTATATGAATGGAAAAGGGGTGCTTCGGATCGGGAGTAA

Protein Analysis

118

Amino Acids

13.53

Weight (kDa)

4.66

Isoelectric Point (pI)

50.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Oxidored_q4 PF00507 26 - 114 3.3e-32 NADH-ubiquinone/plastoquinone oxidoreductase, chain 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023963)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G07751
rosa_chinensis RchiOBHm_MTg0498381
rosa_roxburghii Rroxscaffold_2G00119230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 52, 134, 354
AcsI RAATTY 1 cut(s) 8
AfaI GTAC 1 cut(s) 246
AfiI CCNNNNNNNGG 1 cut(s) 214
AgsI TTSAA 1 cut(s) 192
AlwI GGATC 3 cut(s) 52, 134, 354
AoxI GGCC 2 cut(s) 120, 288
ApoI RAATTY 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 279
AsuHPI GGTGA 1 cut(s) 161
AvaII GGWCC 1 cut(s) 279
BccI CCATC 1 cut(s) 280
BfaI CTAG 1 cut(s) 47
Bme18I GGWCC 1 cut(s) 279
BmgT120I GGNCC 1 cut(s) 279
BmsI GCATC 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 236
BsaWI WCCGGW 1 cut(s) 146
Bsc4I CCNNNNNNNGG 1 cut(s) 214
BseDI CCNNGG 1 cut(s) 236
BseLI CCNNNNNNNGG 1 cut(s) 214
BshFI GGCC 2 cut(s) 122, 290
BsiSI CCGG 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 214
BsnI GGCC 2 cut(s) 122, 290
Bsp143I GATC 5 cut(s) 57, 139, 211, 262, 346
BspANI GGCC 2 cut(s) 122, 290
BspPI GGATC 3 cut(s) 52, 134, 354
BssECI CCNNGG 1 cut(s) 236
BssMI GATC 5 cut(s) 57, 139, 211, 262, 346
BssT1I CCWWGG 1 cut(s) 236
BstKTI GATC 5 cut(s) 60, 142, 214, 265, 349
BstMBI GATC 5 cut(s) 57, 139, 211, 262, 346
BsuRI GGCC 2 cut(s) 122, 290
Cfr13I GGNCC 1 cut(s) 279
Csp6I GTAC 1 cut(s) 245
CviAII CATG 1 cut(s) 283
CviJI RGCY 2 cut(s) 122, 290
CviKI_1 RGCY 2 cut(s) 122, 290
CviQI GTAC 1 cut(s) 245
DpnI GATC 5 cut(s) 59, 141, 213, 264, 348
DpnII GATC 5 cut(s) 57, 139, 211, 262, 346
Eco130I CCWWGG 1 cut(s) 236
Eco47I GGWCC 1 cut(s) 279
EcoT14I CCWWGG 1 cut(s) 236
ErhI CCWWGG 1 cut(s) 236
FaeI CATG 1 cut(s) 286
FaiI YATR 4 cut(s) 173, 284, 322, 324
FalI AAGNNNNNCTT 2 cut(s) 325, 357
FatI CATG 1 cut(s) 282
FspBI CTAG 1 cut(s) 47
HaeIII GGCC 2 cut(s) 122, 290
HapII CCGG 1 cut(s) 147
Hin1II CATG 1 cut(s) 286
HpaII CCGG 1 cut(s) 147
HphI GGTGA 1 cut(s) 161
Hpy188I TCNGA 2 cut(s) 7, 346
Hpy188III TCNNGA 2 cut(s) 215, 350
HpyAV CCTTC 1 cut(s) 153
HpyCH4V TGCA 1 cut(s) 14
Hsp92II CATG 1 cut(s) 286
Kzo9I GATC 5 cut(s) 57, 139, 211, 262, 346
LpnPI CCDG 5 cut(s) 120, 160, 169, 200, 222
LweI GCATC 1 cut(s) 142
MaeI CTAG 1 cut(s) 47
MaeIII GTNAC 1 cut(s) 220
MalI GATC 5 cut(s) 59, 141, 213, 264, 348
MboI GATC 5 cut(s) 57, 139, 211, 262, 346
MluCI AATT 4 cut(s) 8, 18, 113, 192
MnlI CCTC 1 cut(s) 258
MseI TTAA 1 cut(s) 203
MspI CCGG 1 cut(s) 147
NdeII GATC 5 cut(s) 57, 139, 211, 262, 346
NlaIII CATG 1 cut(s) 286
PspPI GGNCC 1 cut(s) 279
RsaI GTAC 1 cut(s) 246
RsaNI GTAC 1 cut(s) 245
SaqAI TTAA 1 cut(s) 203
Sau3AI GATC 5 cut(s) 57, 139, 211, 262, 346
Sau96I GGNCC 1 cut(s) 279
SetI ASST 3 cut(s) 104, 227, 250
SfaNI GCATC 1 cut(s) 142
SinI GGWCC 1 cut(s) 279
Sse9I AATT 4 cut(s) 8, 18, 113, 192
SspMI CTAG 1 cut(s) 47
StyI CCWWGG 1 cut(s) 236
TaqI TCGA 2 cut(s) 138, 168
TasI AATT 4 cut(s) 8, 18, 113, 192
Tru1I TTAA 1 cut(s) 203
Tru9I TTAA 1 cut(s) 203
TspDTI ATGAA 1 cut(s) 339
VpaK11BI GGWCC 1 cut(s) 279
XapI RAATTY 1 cut(s) 8
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.