AT2G39500

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
16489013 .. 16490108
1096 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G39500.1

Sequence Viewer

Length: 168 bp
ATGGCGACGAGATTCGATGTGAAGACGATCGTCAAGGACAAGAGATTCTGGATTGCTTCCTTCATCATCGTCTGGGCTGCTGGTCTTCAGGGTCACATGATGTGGCTGCAGAAGCAAGAATCTTTCAAGCAGAAATTTGGAACAATCGATGAAGACGACCACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.56

Weight (kDa)

9.22

Isoelectric Point (pI)

44.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018337)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G39500
malus_domestica MD01G1123400.v1.1
prunus_persica Prupe.2G230900_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0366131
rosa_roxburghii Rroxscaffold_4G00290470
rosa_samantha Rh1AG335800 Rh1BG297200 Rh1CG313200 Rh1DG329000
rosa_wichuraiana Rw1G029790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 134
AcuI CTGAAG 1 cut(s) 71
AgsI TTSAA 1 cut(s) 127
ApeKI GCWGC 2 cut(s) 77, 106
ApoI RAATTY 1 cut(s) 134
BbsI GAAGAC 3 cut(s) 29, 77, 159
BbvI GCAGC 2 cut(s) 64, 93
BfmI CTRYAG 1 cut(s) 107
BisI GCNGC 2 cut(s) 78, 107
BlsI GCNGC 2 cut(s) 79, 108
BoxI GACNNNNGTC 1 cut(s) 29
BpiI GAAGAC 3 cut(s) 29, 77, 159
Bsa29I ATCGAT 1 cut(s) 147
BseCI ATCGAT 1 cut(s) 147
BseXI GCAGC 2 cut(s) 64, 93
Bsh1285I CGRYCG 1 cut(s) 30
BshVI ATCGAT 1 cut(s) 147
BsiEI CGRYCG 1 cut(s) 30
Bsp143I GATC 1 cut(s) 27
BspDI ATCGAT 1 cut(s) 147
BspMAI CTGCAG 1 cut(s) 111
BssMI GATC 1 cut(s) 27
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BstMCI CGRYCG 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 112
BstPAI GACNNNNGTC 1 cut(s) 29
BstSFI CTRYAG 1 cut(s) 107
BstV1I GCAGC 2 cut(s) 64, 93
BstV2I GAAGAC 3 cut(s) 29, 77, 159
Bsu15I ATCGAT 1 cut(s) 147
BsuTUI ATCGAT 1 cut(s) 147
ClaI ATCGAT 1 cut(s) 147
CviAII CATG 1 cut(s) 97
CviJI RGCY 2 cut(s) 77, 106
CviKI_1 RGCY 2 cut(s) 77, 106
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
Eco57I CTGAAG 1 cut(s) 71
FaeI CATG 1 cut(s) 100
FaiI YATR 1 cut(s) 98
FatI CATG 1 cut(s) 96
Fnu4HI GCNGC 2 cut(s) 78, 107
Fsp4HI GCNGC 2 cut(s) 78, 107
GluI GCNGC 2 cut(s) 78, 107
Hin1II CATG 1 cut(s) 100
HinfI GANTC 3 cut(s) 12, 45, 119
Hpy188III TCNNGA 1 cut(s) 49
Hpy99I CGWCG 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 109
HpyF10VI GCNNNNNNNGC 1 cut(s) 112
Hsp92II CATG 1 cut(s) 100
Kzo9I GATC 1 cut(s) 27
LpnPI CCDG 4 cut(s) 34, 58, 66, 74
Lsp1109I GCAGC 2 cut(s) 64, 93
MaeIII GTNAC 1 cut(s) 92
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 3 cut(s) 34, 77, 164
MluCI AATT 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 112
NdeII GATC 1 cut(s) 27
NlaIII CATG 1 cut(s) 100
NmuCI GTSAC 1 cut(s) 92
PcsI WCGNNNNNNNCGW 1 cut(s) 153
PfeI GAWTC 3 cut(s) 12, 45, 119
PkrI GCNGC 2 cut(s) 79, 108
Ple19I CGATCG 1 cut(s) 30
PshAI GACNNNNGTC 1 cut(s) 29
PstI CTGCAG 1 cut(s) 111
PvuI CGATCG 1 cut(s) 30
SatI GCNGC 2 cut(s) 78, 107
Sau3AI GATC 1 cut(s) 27
SfcI CTRYAG 1 cut(s) 107
Sse9I AATT 1 cut(s) 134
TaqI TCGA 2 cut(s) 15, 147
TasI AATT 1 cut(s) 134
TfiI GAWTC 3 cut(s) 12, 45, 119
TseFI GTSAC 1 cut(s) 92
TseI GCWGC 2 cut(s) 77, 106
Tsp45I GTSAC 1 cut(s) 92
TspDTI ATGAA 2 cut(s) 52, 165
XapI RAATTY 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.