AT3G13845

Has 22 Blast hits to 22 proteins in 10

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
4557293 .. 4558715
1423 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G13845.2

Sequence Viewer

Length: 213 bp
ATGTCGGTGAAACCCACAGTTGCTTTGAGAGGTATCTTAGTAGGTGGAGTGGCGATATTTGCAAAAGTTGCGGCTGCAATGAAAGCAGCTGGAGGTGTTAAGCTTGGTGCAGCTGCTACAGCTATGACCGTGGCTGCAACCGCTGCTGTTAGTGGAGGTTCTAAGCAAGATCAAAAGCAAGATGCTTCCAAGGCACCACCACCTTCTAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

6.68

Weight (kDa)

10.47

Isoelectric Point (pI)

40.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017932)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G13845 AT3G13845
malus_domestica MD09G1192600.v1.1
prunus_persica Prupe.3G048900_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0143441
rosa_roxburghii Rroxscaffold_2G00101840
rosa_samantha Rh2AG434600 Rh2BG442400 Rh2CG420500 Rh2DG452600
rosa_wichuraiana Rw2G035410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 193
AciI CCGC 2 cut(s) 71, 141
AluBI AGCT 4 cut(s) 89, 103, 113, 122
AluI AGCT 4 cut(s) 89, 103, 113, 122
ApeKI GCWGC 6 cut(s) 74, 86, 110, 113, 134, 143
AsuHPI GGTGA 1 cut(s) 19
BanI GGYRCC 1 cut(s) 193
BbvI GCAGC 6 cut(s) 61, 98, 100, 121, 122, 130
BfmI CTRYAG 1 cut(s) 117
BisI GCNGC 7 cut(s) 72, 75, 87, 111, 114, 135, 144
BlsI GCNGC 7 cut(s) 73, 76, 88, 112, 115, 136, 145
BmiI GGNNCC 1 cut(s) 195
BmsI GCATC 1 cut(s) 172
BpmI CTGGAG 1 cut(s) 111
BsaJI CCNNGG 2 cut(s) 129, 189
Bse3DI GCAATG 1 cut(s) 84
BseDI CCNNGG 2 cut(s) 129, 189
BseMI GCAATG 1 cut(s) 84
BseXI GCAGC 6 cut(s) 61, 98, 100, 121, 122, 130
BsgI GTGCAG 1 cut(s) 129
BshNI GGYRCC 1 cut(s) 193
Bsp143I GATC 1 cut(s) 169
BspACI CCGC 2 cut(s) 71, 141
BspLI GGNNCC 1 cut(s) 195
BspT107I GGYRCC 1 cut(s) 193
BsrDI GCAATG 1 cut(s) 84
BssECI CCNNGG 2 cut(s) 129, 189
BssMI GATC 1 cut(s) 169
BssT1I CCWWGG 1 cut(s) 189
Bst4CI ACNGT 2 cut(s) 19, 130
BstAPI GCANNNNNTGC 2 cut(s) 68, 143
BstDEI CTNAG 2 cut(s) 37, 162
BstDSI CCRYGG 1 cut(s) 129
BstKTI GATC 1 cut(s) 172
BstMBI GATC 1 cut(s) 169
BstMWI GCNNNNNNNGC 7 cut(s) 59, 68, 83, 119, 140, 143, 191
BstSFI CTRYAG 1 cut(s) 117
BstV1I GCAGC 6 cut(s) 61, 98, 100, 121, 122, 130
BtgI CCRYGG 1 cut(s) 129
CviJI RGCY 6 cut(s) 74, 89, 103, 113, 122, 134
CviKI_1 RGCY 6 cut(s) 74, 89, 103, 113, 122, 134
DdeI CTNAG 2 cut(s) 37, 162
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
Eco130I CCWWGG 1 cut(s) 189
EcoT14I CCWWGG 1 cut(s) 189
ErhI CCWWGG 1 cut(s) 189
FaiI YATR 1 cut(s) 125
Fnu4HI GCNGC 7 cut(s) 72, 75, 87, 111, 114, 135, 144
Fsp4HI GCNGC 7 cut(s) 72, 75, 87, 111, 114, 135, 144
GluI GCNGC 7 cut(s) 72, 75, 87, 111, 114, 135, 144
GsuI CTGGAG 1 cut(s) 111
HindIII AAGCTT 1 cut(s) 101
HphI GGTGA 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 213
HpyCH4III ACNGT 2 cut(s) 19, 130
HpyCH4V TGCA 4 cut(s) 62, 77, 110, 137
HpyF10VI GCNNNNNNNGC 7 cut(s) 59, 68, 83, 119, 140, 143, 191
HpyF3I CTNAG 2 cut(s) 37, 162
Kzo9I GATC 1 cut(s) 169
LpnPI CCDG 1 cut(s) 75
Lsp1109I GCAGC 6 cut(s) 61, 98, 100, 121, 122, 130
LweI GCATC 1 cut(s) 172
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MnlI CCTC 3 cut(s) 23, 86, 149
MseI TTAA 1 cut(s) 99
MspA1I CMGCKG 3 cut(s) 89, 113, 143
MwoI GCNNNNNNNGC 7 cut(s) 59, 68, 83, 119, 140, 143, 191
NdeII GATC 1 cut(s) 169
NlaIV GGNNCC 1 cut(s) 195
PkrI GCNGC 7 cut(s) 73, 76, 88, 112, 115, 136, 145
PspN4I GGNNCC 1 cut(s) 195
PvuII CAGCTG 2 cut(s) 89, 113
SaqAI TTAA 1 cut(s) 99
SatI GCNGC 7 cut(s) 72, 75, 87, 111, 114, 135, 144
Sau3AI GATC 1 cut(s) 169
SetI ASST 9 cut(s) 34, 46, 91, 97, 105, 115, 124, 160, 205
SfaNI GCATC 1 cut(s) 172
SfcI CTRYAG 1 cut(s) 117
SgeI CNNG 6 cut(s) 102, 116, 142, 179, 191, 202
SsiI CCGC 2 cut(s) 71, 141
StyI CCWWGG 1 cut(s) 189
TaaI ACNGT 2 cut(s) 19, 130
TauI GCSGC 1 cut(s) 74
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TseI GCWGC 6 cut(s) 74, 86, 110, 113, 134, 143
TspDTI ATGAA 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.