AT5G37793

glomerular visceral epithelial cell migration

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
15022612 .. 15025656
3045 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G37793.1

Sequence Viewer

Length: 300 bp
ATGGTCGTATCATCACCGACGGTGGAGGATGGTGGTAGATACGGAGGGCGGTGGAGAGCCGTGAGGGATGAAGTTACGGAGGAAGCGTTGGTCGTGGCTGATCGTTTAAGTCTTCTTCGCCTGAAAGAAGAAGAAGAAGACGGTTTCTCTTCGCTCTTTGTGATTCGAACGGAGGAGACACTAATTGAGGACAAATCTTTATCATTTTGCACTTGTAATGGAGAAAGATGGAGAAGATTGTTTTCTTTCTACAAGTTTCTGAAGCAAGAGCCTCATGAATTCCTGGGGACCATGAAACAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.68

Weight (kDa)

5.08

Isoelectric Point (pI)

75.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019633)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G10843 AT4G10843 AT4G10843 AT4G10843 AT5G37793
malus_domestica MD10G1119400.v1.1
pyrus_communis pycom10g10280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 49
AcsI RAATTY 1 cut(s) 278
AcuI CTGAAG 1 cut(s) 281
AjnI CCWGG 1 cut(s) 282
Alw26I GTCTC 1 cut(s) 170
ApoI RAATTY 1 cut(s) 278
AspS9I GGNCC 1 cut(s) 288
AsuHPI GGTGA 1 cut(s) 6
AsuII TTCGAA 1 cut(s) 166
AvaII GGWCC 1 cut(s) 288
BbsI GAAGAC 2 cut(s) 104, 144
BccI CCATC 2 cut(s) 23, 222
BceAI ACGGC 1 cut(s) 44
BciT130I CCWGG 1 cut(s) 284
BcoDI GTCTC 1 cut(s) 170
Bme1390I CCNGG 1 cut(s) 284
Bme18I GGWCC 1 cut(s) 288
BmgT120I GGNCC 1 cut(s) 288
BmiI GGNNCC 1 cut(s) 289
BmrFI CCNGG 1 cut(s) 284
BpiI GAAGAC 2 cut(s) 104, 144
Bpu14I TTCGAA 1 cut(s) 166
BsaJI CCNNGG 1 cut(s) 283
BsaXI ACNNNNNCTCC 2 cut(s) 71, 101
BseBI CCWGG 1 cut(s) 284
BseDI CCNNGG 1 cut(s) 283
BseGI GGATG 2 cut(s) 34, 73
BseRI GAGGAG 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 170
Bsp119I TTCGAA 1 cut(s) 166
Bsp143I GATC 1 cut(s) 100
BspACI CCGC 1 cut(s) 49
BspHI TCATGA 1 cut(s) 274
BspLI GGNNCC 1 cut(s) 289
BspT104I TTCGAA 1 cut(s) 166
BssECI CCNNGG 1 cut(s) 283
BssMI GATC 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 284
Bst4CI ACNGT 2 cut(s) 22, 143
Bst6I CTCTTC 1 cut(s) 154
BstBI TTCGAA 1 cut(s) 166
BstF5I GGATG 2 cut(s) 34, 73
BstKTI GATC 1 cut(s) 103
BstMAI GTCTC 1 cut(s) 170
BstMBI GATC 1 cut(s) 100
BstNI CCWGG 1 cut(s) 284
BstSCI CCNGG 1 cut(s) 282
BstV2I GAAGAC 2 cut(s) 104, 144
BtsCI GGATG 2 cut(s) 34, 73
CciI TCATGA 1 cut(s) 274
Cfr13I GGNCC 1 cut(s) 288
CviAII CATG 2 cut(s) 275, 292
CviJI RGCY 3 cut(s) 59, 98, 271
CviKI_1 RGCY 3 cut(s) 59, 98, 271
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
Eam1104I CTCTTC 1 cut(s) 154
EarI CTCTTC 1 cut(s) 154
Eco47I GGWCC 1 cut(s) 288
Eco57I CTGAAG 1 cut(s) 281
EcoRI GAATTC 1 cut(s) 278
EcoRII CCWGG 1 cut(s) 282
FaeI CATG 2 cut(s) 278, 295
FaiI YATR 2 cut(s) 276, 293
FatI CATG 2 cut(s) 274, 291
FokI GGATG 2 cut(s) 41, 80
Hin1II CATG 2 cut(s) 278, 295
HinfI GANTC 1 cut(s) 163
HphI GGTGA 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 261
Hpy188III TCNNGA 1 cut(s) 275
Hpy99I CGWCG 1 cut(s) 22
HpyCH4III ACNGT 2 cut(s) 22, 143
HpyCH4V TGCA 1 cut(s) 210
Hsp92II CATG 2 cut(s) 278, 295
Kzo9I GATC 1 cut(s) 100
LpnPI CCDG 3 cut(s) 134, 269, 296
MaeIII GTNAC 1 cut(s) 73
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MboII GAAGA 8 cut(s) 104, 107, 140, 141, 143, 146, 149, 246
MluCI AATT 2 cut(s) 183, 278
MnlI CCTC 7 cut(s) 19, 38, 57, 73, 166, 181, 282
MseI TTAA 1 cut(s) 107
MspR9I CCNGG 1 cut(s) 284
MvaI CCWGG 1 cut(s) 284
NdeII GATC 1 cut(s) 100
NlaIII CATG 2 cut(s) 278, 295
NlaIV GGNNCC 1 cut(s) 289
NspV TTCGAA 1 cut(s) 166
PagI TCATGA 1 cut(s) 274
PcsI WCGNNNNNNNCGW 1 cut(s) 83
PfeI GAWTC 1 cut(s) 163
Psp6I CCWGG 1 cut(s) 282
PspGI CCWGG 1 cut(s) 282
PspN4I GGNNCC 1 cut(s) 289
PspPI GGNCC 1 cut(s) 288
SaqAI TTAA 1 cut(s) 107
Sau3AI GATC 1 cut(s) 100
Sau96I GGNCC 1 cut(s) 288
ScrFI CCNGG 1 cut(s) 284
SfuI TTCGAA 1 cut(s) 166
SgeI CNNG 9 cut(s) 73, 106, 133, 225, 265, 278, 287, 295, 296
SinI GGWCC 1 cut(s) 288
Sse9I AATT 2 cut(s) 183, 278
SsiI CCGC 1 cut(s) 49
StyD4I CCNGG 1 cut(s) 282
TaaI ACNGT 2 cut(s) 22, 143
TaqI TCGA 1 cut(s) 166
TasI AATT 2 cut(s) 183, 278
TfiI GAWTC 1 cut(s) 163
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 84, 291
TspGWI ACGGA 3 cut(s) 57, 92, 185
VpaK11BI GGWCC 1 cut(s) 288
XapI RAATTY 1 cut(s) 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.